FISH (fluorescence in situ hybridization) probe, kit and detection method for detecting BCR/ABL fusion gene free from repetitive sequence

A technology of fusing genes and repeating sequences, applied in the field of FISH probes, can solve the problems of reducing the specificity and sensitivity of FISH detection

Inactive Publication Date: 2013-11-27
WUHAN HEALTHCHART BIOLOGICAL TECH
View PDF1 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, fluorescent in situ hybridization probes are mainly prepared using artificial chromosomes, which include yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) and phage artificial chromosomes (PAC), etc., due to the existence of many repetitive sequences in artificial chromosomes, These repetitive sequences appear continuously throughout the genome, resulting in the preparation of fluorescent in situ hybridization probes with many repetitive sequences, which can also produce fluorescence after the probe hybridizes with non-target DNA, resulting in non-specific fluorescent signals , greatly reducing the specificity and sensitivity of FISH detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • FISH (fluorescence in situ hybridization) probe, kit and detection method for detecting BCR/ABL fusion gene free from repetitive sequence
  • FISH (fluorescence in situ hybridization) probe, kit and detection method for detecting BCR/ABL fusion gene free from repetitive sequence
  • FISH (fluorescence in situ hybridization) probe, kit and detection method for detecting BCR/ABL fusion gene free from repetitive sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0116] Synthesis of primer sets: through the online analysis database Repeat Masking ( http: / / www.girinst.org / ) analyze the BCR gene and the ABL gene, and obtain the repeated and non-repeated sequences of the BCR gene and the ABL gene (such as figure 1 , figure 2 shown), import the non-repeated sequence into the primer design software Primer5 for primer design, design the amplified product of the primers to be 350-800bp, and synthesize the following 42 pairs of primers by artificial synthesis, 1-20 pairs of the 42 pairs of primers are BCR gene primer set, 21-42 pairs are ABL gene primer set:

[0117] 1F: 5' TCTCCCTCGCAGAACTCGC 3'

[0118] 1R: 5' CAAACCACTCCCATCCCT 3'

[0119] 2F: 5' GTGCCTGTCAACTTTTCTTCC 3'

[0120] 2R: 5' ATCTGCCCACTCTGTCTCC 3'

[0121] 3F: 5' AGCAATCAGCACATTCATAGACC 3'

[0122] 3R: 5' AGAACCTGCACAACAGACCAC 3'

[0123] 4F: 5' AAGCAACCTACAGGCAACA 3'

[0124] 4R: 5' TGAGCCCTCCCACCTAAAA 3'

[0125] 5F: 5'AGTTCCTGCTTGGCTTTCA 3'

[0126] 5R: 5'TTCAGCT...

Embodiment 2

[0203] BCR gene BAC clone construction, the steps are as follows:

[0204] ① Genomic DNA preparation: DNA in chronic myelogenous leukemia tissue was extracted using a commercially available DNA extraction kit;

[0205] ② Enzymatic digestion of genomic DNA: select restriction endonuclease HindⅢ to digest genomic DNA, and perform DNA electrophoresis on the digested products. After electrophoresis, select and recover DNA fragments of 200-300kb fragments;

[0206] ③ Ligation of large fragment DNA and BAC clone: ​​use commercially available pIndigoBAC-5 as the carrier, and construct the connection system according to the mass ratio of vector to large fragment DNA at a ratio of 1:10;

[0207]

[0208] Ligation at 16°C for 16 hours; treatment at 65°C for 20 minutes to inactivate T4 ligase; the ligation product was dialyzed with 0.025um Millipore membrane for 3 hours, the dialyzed ligation product was divided into 0.5ml centrifuge tubes, transformed into DH10B cells and cultured s...

Embodiment 3

[0211] ABL gene BAC clone construction, the specific operation steps are roughly the same as in Example 3, the difference lies in step (4) screening of ABL gene BAC clone: ​​primers are designed for the ABL gene, and the ABL clone constructed above is screened by PCR method. The fragments with PCR products were recovered, sequenced and analyzed after being transferred into the T vector, and the ABL gene sequence was compared, and those that matched the ABL gene were BAC clones containing the ABL gene.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology, and discloses a FISH (fluorescence in situ hybridization) probe, a kit and a detection method for detecting BCR / ABL fusion gene free from repetitive sequence. A BCR gene and ABL gene are used as templates to perform polymerase chain reaction on non-repetitive sequence in the BCR gene and ABL gene, the amplification product is DNA (deoxyribonucleic acid) fragments with 350-800 different base-pairs, the repetitive sequences in the BCR gene and ABL gene are eliminated so as to form the product free from repetitive sequence; after the product is in fluorescence labeling, the BCR gene and ABL gene free from repetitive FISH are obtained for the BCR gene and ABL gene FISH detection. The BCR / ABL fusion gene FISH probe obtained by the invention can be used for eliminating the repetitive sequence, the non-specific background signal of the FISH probe can be obviously reduced, and the specificity of the FISH probe is improved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a FISH probe, a kit and a detection method for detecting BCR / ABL fusion genes without repetitive sequences. Background technique [0002] Chronic myelogenous leukemia (CML) is a malignant clonal proliferative disease of the blood system that occurs in hematopoietic stem cells. Ph marker chromosome or / and BCR / ABL gene rearrangements can be found in affected cell lines. [0003] The human ABL gene is located on the long arm of chromosome 9 and has 12 exons, 1b, 1a, and 2-11. Transcription starts from 1b or 1a, and the lengths of the two messenger RNAs (mRNA) formed are 7kb and 6kb respectively, and the molecular weights of the two synthesized proteins are both about 145. The former is located in the cell membrane, while the latter is mainly in the nucleus. In the blood cells of more than 90% of CML patients, the C-abl proto-oncogene on the long arm of chromosome 9 translocates to the b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor叶伦薛力泉李雪梅付金玲陈刚
OwnerWUHAN HEALTHCHART BIOLOGICAL TECH