Gene knockout vector and zebra fish glioma model thereof

A gene knockout and zebrafish technology, applied in the direction of using vectors to introduce foreign genetic material, genetic engineering, other methods of inserting foreign genetic material, etc., can solve the problems of animal embryo lethality, difficulty in applying the pathogenesis of glioma patients, etc.

Inactive Publication Date: 2018-05-04
SHANTOU UNIV MEDICAL COLLEGE
View PDF0 Cites 37 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] In view of the shortcomings of the prior art described above, the purpose of the present invention is to provide a gene knockout vector and its zebrafish glioma model, which are used to solve the problem that the glioma-based animal model in the prior art is prone to lethal animal embryos 、 Difficult to apply to explain the pathogenesis of glioma patients with different genetic backgrounds

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene knockout vector and zebra fish glioma model thereof
  • Gene knockout vector and zebra fish glioma model thereof
  • Gene knockout vector and zebra fish glioma model thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] Establishment of zebrafish glioma model

[0079] Step 1: Construct the gRNA sequence of the targeting sequence

[0080] Firstly, the CDs sequences of the rb1nf1 and tp53 genes of zebrafish were found on the website of NCBI (National Center for Biotechnology Information, USA). Find the target site sequence on the chopchop website, the target sequences of the three locked genes are

[0081] rb1:TGCATGGAGAATATGGGAGA;

[0082] nf1:GGCGCACAAGCCCGTGGAAT;

[0083] tp53:TGATTGTGAGGATGGGCCTG.

[0084] Then, to construct the targeting sequence gRNA, synthesize the following primers:

[0085] rb1-gRNA-F: TAATACGACTCACTATAGGGTGCATGGAGAATATGGGAGAGTTTTTAGAGCTAGAAATAGC

[0086] nf1-gRNA-F: TAATACGACTCACTATAGGGGCGCACAAGCCCGTGGAATGTTTTTAGAGCTAGAAATAGC

[0087] tp53-gRNA-F: TAATACGACTCACTATAGGGTGATTGTGAGGATGGGCCTGGTTTTAGAGCTAGAAATAGC

[0088] gRNA-R:AGCACCGACTCGGTGCCAC

[0089] Among them, gRNA-R is a general downstream primer synthesized by three gRNAs.

[0090]Using the plasmi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a gene knockout vector and a zebra fish glioma model thereof. The gene knockout vector is obtained by connecting a target sequence to plasmids capable of expressing CRISPR-Cas9gene editing system related enzymes, and the target gene is a p53, Rb1 or Nf1 gene. The CRISPR / CAS9 technology is utilized for performing targeted knockout of rb1, nf1 and tp53 genes, an established transgene-induced malignant glioma zebra fish model can observe occurrence of malignant gliomas, tumor-induced angiogenesis and glioma stem cell generating processes through real-time fluorescence, andthe difference of pathogenesis of gliomas under different genetic background conditions is studied through the molecular biotechnology.

Description

technical field [0001] The present invention relates to the technical field of gene modification of CRISPR / Cas9, in particular to a method for using the technology to induce fluorescent protein expression using an endogenous promoter without destroying the gene, in particular to a gene knockout vector and its zebrafish Glioma model. Background technique [0002] CRISPR / Cas9 (Clustered Regularly Interspaced Short Palindromic Repeat / CRISPR-associated nuclease 9) gene editing system is a new type of gene editing technology developed based on the immune mechanism of archaea against foreign nucleic acid invasion. Compared with the traditional gene editing system, this system has the characteristics of high mutation efficiency, simple production and low cost. At present, this technology has been successfully applied to the precise genome modification of human cells, zebrafish, mice, and bacteria. The types of modification include gene-directed knockout, gene-directed knock-in, si...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/63C12N15/65C12N15/90A01K67/027A01K67/02
CPCC12N15/63A01K67/02A01K67/0276A01K2217/075A01K2227/40A01K2267/0331C07K14/461C12N15/65C12N15/902
Inventor杨小骏罗娟娟
OwnerSHANTOU UNIV MEDICAL COLLEGE