Modified keto reductase mutant and preparation method and application thereof

A mutant and reductase technology, applied in the field of genetic engineering, can solve the problems of difficult biocatalytic production of unnatural substrates, unpredictable activity, and large unpredictability of activity and selectivity

Active Publication Date: 2018-05-18
JILIN ASYMCHEM LAB CO LTD
View PDF15 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] Although several ketoreductases have been mutated to obtain mutants, they are not suitable for all unnatural substrates, and often have unpredictable activity and unpredictable selectivity for specific unnatural substrates. The biocatalytic production of substances brings difficulties, and the stability and selectivity can be further improved. At the same time, ketoreductases from different species are used to catalyze specific unnatural substrates, and their activity and selectivity are more unpredictable. And whether its mutants can achieve continuous production of chiral alcohols through their own coenzyme reduction is a key issue

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modified keto reductase mutant and preparation method and application thereof
  • Modified keto reductase mutant and preparation method and application thereof
  • Modified keto reductase mutant and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] The ketoreductase mutant of embodiment 1 single point mutation (F12Y)

[0076] Construction of ketoreductase mutant gene:

[0077] In order to improve the activity, stability, soluble expression and selectivity of the ketoreductase ZrKR (its amino acid sequence is SEQ ID NO.1 and its encoding nucleotide sequence is SEQ ID NO.2) derived from Zygosaccharomyces rouxii , reduce the amount of enzyme used, perform homologous simulation of ketoreductase ZrKR on swissmodel, create a PDB file of the three-dimensional structure of the ZrKR protein, and use PYMOL software to analyze the three-dimensional structure of the protein. Amino acid mutations are designed near the site, near the cofactor binding site, on the surface of the enzyme molecule, etc., so as to realize the transformation of the enzyme.

[0078] To mutate the F12Y site respectively, the specific steps are as follows:

[0079] (1) Introducing mutations: designing forward and reverse primers comprising the F12Y si...

Embodiment 2

[0092] Ketoreductase mutant of embodiment 2 single point mutation (V13Y)

[0093] Perform site-directed mutation on V13Y, the specific steps are as follows:

[0094] Introducing mutations: designing forward and reverse primers containing the V13Y site, the forward and reverse primers are as follows:

[0095] Upstream primer (SEQ ID NO.12): gtcactggtgctaacggtttctatgctcaacacgttgttcatcaa;

[0096] Downstream primer (SEQ ID NO.13): ttgatgaacaacgtgttgagcatagaaaccgttagcaccagtgac;

[0097] Other methods and steps are the same as in Example 1.

Embodiment 3

[0098] The ketoreductase mutant of embodiment 3 single point mutation (V13I)

[0099] Introducing mutations: designing forward and reverse primers containing the Y13I site, the forward and reverse primers are as follows:

[0100] Upstream primer (SEQ ID NO.14): ctggtgctaacggtttcatcgctcaacacgttgtt;

[0101] Downstream primer (SEQ ID NO.15): aacaacgtgttgagcgatgaaaccgttagcaccag;

[0102] Other methods and steps are the same as in Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of genetic engineering, in particular to modified keto reductase mutant and a preparation method and application thereof. The modified keto reductase mutant has any one of amino acid sequences shown in (I) and (II), to be specific, the amino acid sequence (I) is least 80% the same as that shown in SEQ ID NO. 1, and the amino acid sequence (II) is formedby subjecting amino acids 12 to 214 in the amino acid sequence of SEQ ID NO. 1 to modification, substitution, deletion or addition of one or more amid acids; the substitution refers to substitution of 1-14 amino acids, wherein the modified keto reductase mutant is active the same as keto reductase. By designing mutations for the multiple sites of amino acids 12 to 214, these mutations provide improved activity, stability, soluble expression and selectivity for keto reductase and also enables less keto reductase to be used.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to an improved ketoreductase mutant and its preparation method and application. Background technique [0002] Chiral alcohols are a very important class of chiral compounds, and are important intermediates in the synthesis of chiral drugs and natural products. There are significant differences in the pharmacological activity, metabolic process and toxicity of the enantiomers of chemical drugs containing chiral factors in the human body. The current research on chiral drugs has become one of the main directions of international new drug research. [0003] Chiral alcohol compounds have important applications in drug synthesis, agricultural chemicals and other fine chemicals, such as 3-chloro-1-(4-fluorophenyl)propan-1-ol and its derivatives are synthetic antidepressant drugs It is an important intermediate of moxetine and nisoxetine, and has important application value. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/04C12N15/53C12P17/12C12P7/22
CPCC12N9/0006C12P7/22C12P17/12
Inventor卢江平刘芳于文燕
OwnerJILIN ASYMCHEM LAB CO LTD