Sinonovacula-constricta I-type lysozyme-2 genes, encoded protein and construction method of recombinant sinonovacula-constricta I-type lysozyme-2 gene engineering bacteria

A technology of genetically engineered bacteria and encoded proteins, applied in genetic engineering, plant genetic improvement, peptide/protein components, etc., can solve food safety problems, restrict the survival and growth of razor clams, and increase marine pollution, etc., and achieve the effect of low cost

Active Publication Date: 2018-05-18
NINGBO UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, with the economic development of coastal cities, marine pollution is increasing day by day, resulting in frequent occurrence of diseases in cultured razor clams, especially the diseases caused by bacterial diseases have seriously restricted the survival and growth of razor clams
At present, antibiotics are mostly used for prevention and control in razor clam farming, but the large-scale use of antibiotics has led to the emergence of "super bacteria" and food safety problems caused by antibiotic residues have become increasingly prominent. People urgently need to develop new antibacterial agents for prevention and treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sinonovacula-constricta I-type lysozyme-2 genes, encoded protein and construction method of recombinant sinonovacula-constricta I-type lysozyme-2 gene engineering bacteria
  • Sinonovacula-constricta I-type lysozyme-2 genes, encoded protein and construction method of recombinant sinonovacula-constricta I-type lysozyme-2 gene engineering bacteria
  • Sinonovacula-constricta I-type lysozyme-2 genes, encoded protein and construction method of recombinant sinonovacula-constricta I-type lysozyme-2 gene engineering bacteria

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment 1

[0045] Cloning and sequence analysis of type I lysozyme-2 gene

[0046] (1) Through the previous EST (Expressed Sequence Tag) analysis of the cDNA library of Vibrio parahaemolyticus-induced razor clams, an EST sequence encoding the type I lysozyme-2 gene was found, and the sequencing analysis of this EST clone showed that the clone A partial fragment encoding razor clam type I lysozyme-2;

[0047] (2) RACE primer design: 3' RACE nested primers were designed according to the EST clone encoding a partial fragment of the razor clam type I lysozyme-2 gene: 3' upstream specific amplification primer 1: CAGTTCCTCCCGGACCTGTTGA, 3' upstream specific amplification Amplified primer 2: GCCAGACGTACGCTAGGGAACAC, amplified 3' adapter primer Adaptor3: GGCCACGCGTCGACTAGTACTT;

[0048] (3) Using 3’RACE amplification to obtain the full-length sequence of the razor clam type I lysozyme-2 gene, the specific steps are as follows:

[0049] a. Total RNA extraction: Take the hepatopancreas tissue (...

specific Embodiment 2

[0053] Construction and Expression of Type I Lysozyme-2 Genetic Engineering Bacteria

[0054] a. Total RNA extraction: Take the hepatopancreas tissue (0.2 g-1 g) of razor clam constrictor into a 1.5 mL RNA free centrifuge tube, add 1.0 mL of Trizol reagent (purchased from Takara Company), and fully homogenize with a homogenizer. Centrifuge at 12000 g at 4 °C for 5 min, take the supernatant, add 0.2 mL of chloroform, shake and mix, let stand at room temperature for 5 min, centrifuge at 12000 g at 4 °C for 15 min, draw the supernatant into a centrifuge tube, add the Add an equal volume of isopropanol to the supernatant, mix well, let stand at room temperature for 5 min, centrifuge at 12,000 rpm for 5 min at 4 °C, remove the supernatant, add 1 mL of ethanol with a mass percentage concentration of 75% to the precipitate, 4 °C, Centrifuge at 12,000 rpm for 5 min, discard the supernatant, add 1 mL of 75% ethanol to the pellet to resuspend the pellet, centrifuge at 12,000 rpm for 5 ...

specific Embodiment 3

[0061] Purification of recombinant proteins

[0062] a. Bacteria lysis: resuspend 100 mL of bacterial sediment in 10 mL lysis buffer (imidazole concentration: 5 mM), add 1 mg / mL lysozyme, incubate on ice for 30 min, and ultrasonically disrupt the bacteria (ultrasonic 5 s, stop for 10 s, a total of 6 times, power 30w, 2 min), 10000 g, 4 ℃, centrifuge 20 min, collect the supernatant.

[0063] b. Protein purification: draw 1 mL Ni-NTA Sefinose TM Put Resin on the column, wash twice with sterile water, and then equilibrate once with lysis buffer (imidazole concentration 5mM); mix the supernatant with the Ni-NTA Sefinose that was previously loaded TM Resin was mixed, mixed for 2 h at 4 ℃, the effluent was collected, and washed buffer (imidazole concentration 40 mM), eluted twice each time with 10 mL, the effluent was collected separately, and 1.25 mL elution buffer (imidazole concentration 250 mM) was added , eluted 4 times, and the effluents were collected respectively. Take th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses sinonovacula-constricta I-type lysozyme-2 genes, encoded protein and an construction method and application of recombinant sinonovacula-constricta I-type lysozyme-2 gene engineering bacteria. The sinonovacula-constricta I-type lysozyme-2 genes are characterized in that sequences of the sinonovacula-constricta I-type lysozyme-2 genes are shown in SEQID NO.1; a clone method of the sinonovacula-constricta I-type lysozyme-2 genes is characterized in that nested primers of 3'RACE are designed according to expression sequence tag (EST) sequences homologous with the sinonovacula-constricta I-type lysozyme-2 genes, and the full length of the genes is amplified with the 3'RACE technology; amino acid sequences of the sinonovacula-constricta I-type lysozyme-2 gene encoded protein are shown in SEQID NO.2, and the sinonovacula-constricta I-type lysozyme-2 protein is amplified with primers containing BamH I loci and Xho I loci respectively; target genes obtained after cloningare inserted into carriers to obtain recombinant plasmids, the recombinant plasmids are subjected to inducible expression and then are purified, and the gene engineering bacteria are obtained. The gene engineering bacteria have the inhibiting effect on vibrio harveyi, vibrio parahaemolyticus and vibrio splendidus.

Description

technical field [0001] The invention belongs to the fields of molecular biology and genetic engineering, and in particular relates to a construction method and application of a razor clam type I lysozyme-2 gene, a coded protein and a recombinant razor clam type I lysozyme-2 genetic engineering bacterium. Background technique [0002] Antimicrobial peptides / proteins are a class of amphipathic small molecule basic polypeptides that widely exist in the entire biological world, and are key factors in the body's innate immunity. After Steiner first discovered it in the silkworm, so far, more than 1,000 antimicrobial peptides have been found in various organisms. According to the sequence, secondary structure and antibacterial properties of antimicrobial peptides, the discovered antimicrobial peptides are divided into four categories: (1) linear antimicrobial peptides without cysteine, such as cecropin, magainin, etc.; (2) cyclic antimicrobial peptides with cysteine, such as defe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/56C12N15/10C12N9/36C12N15/70C12N15/66A61K38/47A61P31/04
CPCA61K38/00C12N9/2462C12N15/1096C12N15/66C12N15/70C12Y302/01017C12Q2531/113
Inventor李成华邵铱娜张卫卫赵雪琳
OwnerNINGBO UNIV