Neutral proteinase gene constructed by molecular chaperone prsA, protein, bacillus subtilis, preparation and application
A Bacillus subtilis, neutral protease technology, applied in DNA preparation, expression enhancement stability/folding protein fusion, application, etc., can solve the problems of easy pollution, restriction enzyme secretion and expression, fire hazard and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0078] 1. The neutral protease gene constructed by molecular chaperone prsA, its gene sequence is:
[0079]gctgagaatcctcagcttaaagaaaacctgacgaactttgtgccgaagcattctttggtgcaatctgaattgccttcagtcagtgacaaagcaatcaagcaatacttgaaacaaaacggcaaagtcttcaaaggcaacccttctgagagactgaagctaattgaccacacgaccgatgatctcggctacaagcacttccgttatgtgcctgtcgttaacggtgtgcctgtgaaagactcgcaagtcattattcacgtcgataaatccaacaatgtctatgcgattaacggagaattaaacaacgatgcttctgccaaaacggcaaacagcaaaaaattatctgcaaatcaagcgctggatcatgcttttaaagcaatcggcaaatcacctgaagccgtctctaacggcaacgttgcaaacaaaaacaaagccgagctgaaagcagcggccacaaaagacggtaaataccgactcgcctatgatgtaaccatccgctacatcgaaccggaaccagctaactgggaagtaaccgttgatgcggaaacagggaaagtcctgaaaaagcaaaacaaagtggagcatgccgctgcaaccggaacaggtacgactcttaaaggaaaaacggtctcattaaatatttcttctgaaagcggcaaatatgtaatgcgtgatctttctaaacctaccggaacgcaaattattacgtacgatctgcaaaaccgacaatataacctgccgggcacgctcgtatcaagcactacaaaccagttcacaacttcttctcagcgcgctgccgttgatgcgcattacaatctcggcaaagtgtacgattatttctatcagacgtttaaacgcaacagctacgacaataaaggcggcaaaatcgt...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



