Edited inactivation vector of tobacco nicotine demethylase gene cyp82e4 and its application
A technology of CYP82E4 and demethylase, applied in application, genetic engineering, plant gene improvement, etc., to achieve the effect of improving the quality of tobacco
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Embodiment 1, the acquisition of tobacco CYP82E4 gene fragment
[0024] Using the genomic DNA of Burley tobacco TN90 as a template, the following primers were designed for PCR amplification;
[0025] CYP82E4-fragment-F: 5'-tggaattatgcccatcctaca-3' (SEQ ID NO.1);
[0026] CYP82E4-fragment-R: 5'-cattagtggttgcacctgagg-3' (SEQ ID NO.2);
[0027]PCR amplification conditions were: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 40 s, annealing at 56°C for 40 s, extension at 72°C for 1 min and 10 s, 30 cycles; extension at 72°C for 10 min, and storage at 4°C. After the reaction, 4 μL of the PCR product was taken, detected by 1.0% agarose gel electrophoresis, and sequence determination was performed on the obtained fragment.
[0028] The CYP82E4 gene fragment was amplified, and the specific sequence is shown in SEQ ID NO.3 below:
[0029] tggaattatgcccatcctacagttacctataaaaaggaagttgccgatagttatattctcaacttcttatctaaaaatccataatgctttctcccatagaagccattgtaggactagtaaccttc...
Embodiment 2
[0030] Example 2, CYP82E4 gene editing target sequence information and gene editing inactivation vector construction
[0031] In the amplified CYP82E4 gene fragment sequence, "gaaaatccccggaggatggc" (SEQ ID NO.4) was selected as the target site to be edited. Refer to the published method of overlapping PCR to construct the edited inactivation vector of the gene. For the specific process, see figure 1 shown. The sgRNA containing the CYP82E4 target sequence was ligated into the Cas9 gene editing vector by two rounds of PCR. In the first round of PCR, using the complete sgRNA expression cassette (SEQ ID NO.14) as a template, using HindIII-U26-F1 and CYP82E4-1-R1 primers, CYP82E4-1-F2 and NheI-U26-R2 primers to amplify respectively The upstream and downstream fragments, and then the two amplified fragments were mixed as a template, and HindIII-U26-F1 and NheI-U26-R2 were used as primers to amplify the full-length sgRNA containing the CYP82E4 target site sequence (SEQ ID NO. 15),...
Embodiment 3
[0047] Embodiment 3, engineering bacterium preparation and transgenic tobacco preparation
[0048] Knockout vector transformation Agrobacterium preparation, the specific steps are as follows:
[0049] 1) Add ≦1 μg of pORE-Cas9-CYP82E4editing recombinant plasmid with correct sequencing to 100 μL of Agrobacterium competent cells (add when the competent cells are just dissolved), lightly flick and mix, and ice-bath for 30 minutes;
[0050] 2) Immediately heat-shock in a 37°C water bath for 5 minutes after quick-freezing in liquid nitrogen for 1 minute;
[0051] 3) Add 1 mL of YEB liquid medium, and incubate at 28° C. and 220 rpm for 4-6 hours (flocculents appear).
[0052] 4) Centrifuge at 4000rpm for 3min, discard the supernatant, add 200μL of fresh YEB medium, blow and mix with a pipette tip, and spread evenly on the YEB solid plate (final concentration of Rif is 50mg / L, final concentration of Str is 50mg / L, final concentration of Kana Concentration 50mg / L), 28°C, dark cultur...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More