Unlock instant, AI-driven research and patent intelligence for your innovation.
Gene with triacylglycerol synthesis function and application of gene in rational regulation of content or saturation degree of oil-producing microalgae triacylglycerol
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A triacylglycerol, gene technology, applied in application, genetic engineering, acyltransferase and other directions, can solve the problems of low oil yield and oil saturation that has not yet reached the application standard.
Active Publication Date: 2018-06-29
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF2 Cites 3 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, at present, microalgae oil production also faces many bottlenecks, such as low oil yield, and oil saturation has not yet reached the application standard, etc.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0045] Example 1: Cloning and analysis of NoDGAT gene
[0046] The NoDGAT2A, 2C and 2D genes and their flanking sequences were respectively cloned from the gDNA and cDNA of IMET1 by PCR technology. Restriction sites, synthesized by Shanghai Sangong:
[0047] NoDGAT2A primer pair is
[0048] 1) NoDGAT2A-for:
[0049] 5'GGTACCACATAATGACGCCGCAAGCCGAC3';
[0050] 2) NoDGAT2A-rev:
[0051] 5'GAATTCTTACTCAATGGACAACGGGCGCGTCT 3';
[0052] 3) NoDGAT2C primer pair is NoDGAT2C-for:
[0053] 5'GGTACCACATAATGACATCCTCCCCACC 3';
[0054] 4) NoDGAT2C-rev:
[0055] 5'GAATTCTCACCTGACCACTAAGGTGGCC 3';
[0056] NoDGAT2D primer pair is
[0057] 5) NoDGAT2D-for:
[0058] 5' GGTACCACATAATGAAGAAAATCTTGCGC 3';
[0059] 6) NoDGAT2D-rev:
[0060] 5'GAATTCCTAATAAAGCTCCAGCTCCCTGT 3'.
[0061] The PCR machine used was MasterCycler from Eppendorf Company, the reaction system was 50 μL, including 4 μL dNTP (2.5 mM each, TAKARA), 2 μL each of forward and reverse primers (10 μM), 5 μL 10×buffer (...
Embodiment 2
[0064] Example 2: Overexpression of NoDGAT in marine Nannochloropsis IMET1
[0065] (1) Construction of endogenous overexpression vector
[0066] see figure 2 . The specific method for constructing the vector is as follows: the full-length ORF fragment of NoDGAT is amplified by using the cDNA of Nannochloropsis IMET1 as a template by PCR method. In order to construct the cloning, with the help of primer introduction method, a restriction site and a protective base are added to the 5' end of the target sequence, and a restriction site is added to its 3' end. The sequence of the primer pair is as follows:
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention belongs to the biological technical field, and relates to a gene with a triacylglycerol (TAG) synthesis function and the application of the gene in increase of the TAG content and rational regulation of the saturation degree of microalgae TAG. The gene is a base sequence as shown in SEQ ID NO 1, a base sequence as shown in SEQ ID NO 2 or a base sequence as shown in SEQ ID NO 3, and aDNA sequence which is homologous with the base sequence as shown in SEQ ID NO 1, the base sequence as shown in SEQ ID NO 2 or the base sequence as shown in SEQ ID NO 3 by 95 percent or above and encodes identical biological functional protein. The gene disclosed by the invention comprises three DGAT (diacylglycerol acyltransferase) genes separated from nannochloropsis. The obtained gene is used for rationally regulating the content and the saturation degree of TAG. Biodiesel, a health care product, a medicine and the like have demands for saturation degree of intracellulartriglyceride to different extents.
Description
technical field [0001] The invention belongs to the field of biotechnology. The invention relates to a gene with triacylglycerol (TAG) synthesis function and the application of the gene in increasing the TAG content and rationally regulating the TAG saturation of microalgae. Background technique [0002] Under the guidance of the concepts of energy saving, emission reduction, and low carbon, the development of renewable energy has become an important research direction. At present, most renewable energy sources provide energy in the form of power generation, but since most transportation vehicles still use liquid fuels as energy sources, electric energy cannot directly solve the power problem of current transportation vehicles. Biofuel is currently the only renewable energy that can be used as liquid fuel, so it occupies an important position in the development of renewable energy. Among them, biodiesel is most suitable for the current internal combustion enginesystem, wh...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More