Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene with triacylglycerol synthesis function and application of gene in rational regulation of content or saturation degree of oil-producing microalgae triacylglycerol

A triacylglycerol, gene technology, applied in application, genetic engineering, acyltransferase and other directions, can solve the problems of low oil yield and oil saturation that has not yet reached the application standard.

Active Publication Date: 2018-06-29
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, microalgae oil production also faces many bottlenecks, such as low oil yield, and oil saturation has not yet reached the application standard, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene with triacylglycerol synthesis function and application of gene in rational regulation of content or saturation degree of oil-producing microalgae triacylglycerol
  • Gene with triacylglycerol synthesis function and application of gene in rational regulation of content or saturation degree of oil-producing microalgae triacylglycerol
  • Gene with triacylglycerol synthesis function and application of gene in rational regulation of content or saturation degree of oil-producing microalgae triacylglycerol

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: Cloning and analysis of NoDGAT gene

[0046] The NoDGAT2A, 2C and 2D genes and their flanking sequences were respectively cloned from the gDNA and cDNA of IMET1 by PCR technology. Restriction sites, synthesized by Shanghai Sangong:

[0047] NoDGAT2A primer pair is

[0048] 1) NoDGAT2A-for:

[0049] 5'GGTACCACATAATGACGCCGCAAGCCGAC3';

[0050] 2) NoDGAT2A-rev:

[0051] 5'GAATTCTTACTCAATGGACAACGGGCGCGTCT 3';

[0052] 3) NoDGAT2C primer pair is NoDGAT2C-for:

[0053] 5'GGTACCACATAATGACATCCTCCCCACC 3';

[0054] 4) NoDGAT2C-rev:

[0055] 5'GAATTCTCACCTGACCACTAAGGTGGCC 3';

[0056] NoDGAT2D primer pair is

[0057] 5) NoDGAT2D-for:

[0058] 5' GGTACCACATAATGAAGAAAATCTTGCGC 3';

[0059] 6) NoDGAT2D-rev:

[0060] 5'GAATTCCTAATAAAGCTCCAGCTCCCTGT 3'.

[0061] The PCR machine used was MasterCycler from Eppendorf Company, the reaction system was 50 μL, including 4 μL dNTP (2.5 mM each, TAKARA), 2 μL each of forward and reverse primers (10 μM), 5 μL 10×buffer (...

Embodiment 2

[0064] Example 2: Overexpression of NoDGAT in marine Nannochloropsis IMET1

[0065] (1) Construction of endogenous overexpression vector

[0066] see figure 2 . The specific method for constructing the vector is as follows: the full-length ORF fragment of NoDGAT is amplified by using the cDNA of Nannochloropsis IMET1 as a template by PCR method. In order to construct the cloning, with the help of primer introduction method, a restriction site and a protective base are added to the 5' end of the target sequence, and a restriction site is added to its 3' end. The sequence of the primer pair is as follows:

[0067] NoDGAT2A primer pair is

[0068] 1) NoDGAT2A-oe-for:

[0069] 5' CCGCTCGAGATGACGCCGCAAG 3';

[0070] 2) NoDGAT2A-oe-rev:

[0071] 5'GAATTCTTAGTGGTGGTGGTGGTGGTGCTCAATGGAC 3';

[0072] 3) NoDGAT2C primer pair is NoDGAT2C-oe-for:

[0073] 5'CCGCTCGAGATGACATCCTCCCC 3';

[0074] 4) NoDGAT2C-oe-rev:

[0075] 5'GAATTCTCAGTGGTGGTGGTGGTGGTGCCTGACCACT 3';

[0076] No...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the biological technical field, and relates to a gene with a triacylglycerol (TAG) synthesis function and the application of the gene in increase of the TAG content and rational regulation of the saturation degree of microalgae TAG. The gene is a base sequence as shown in SEQ ID NO 1, a base sequence as shown in SEQ ID NO 2 or a base sequence as shown in SEQ ID NO 3, and aDNA sequence which is homologous with the base sequence as shown in SEQ ID NO 1, the base sequence as shown in SEQ ID NO 2 or the base sequence as shown in SEQ ID NO 3 by 95 percent or above and encodes identical biological functional protein. The gene disclosed by the invention comprises three DGAT (diacylglycerol acyltransferase) genes separated from nannochloropsis. The obtained gene is used for rationally regulating the content and the saturation degree of TAG. Biodiesel, a health care product, a medicine and the like have demands for saturation degree of intracellular triglyceride to different extents.

Description

technical field [0001] The invention belongs to the field of biotechnology. The invention relates to a gene with triacylglycerol (TAG) synthesis function and the application of the gene in increasing the TAG content and rationally regulating the TAG saturation of microalgae. Background technique [0002] Under the guidance of the concepts of energy saving, emission reduction, and low carbon, the development of renewable energy has become an important research direction. At present, most renewable energy sources provide energy in the form of power generation, but since most transportation vehicles still use liquid fuels as energy sources, electric energy cannot directly solve the power problem of current transportation vehicles. Biofuel is currently the only renewable energy that can be used as liquid fuel, so it occupies an important position in the development of renewable energy. Among them, biodiesel is most suitable for the current internal combustion engine system, wh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/10C12N15/11C12N15/79C12N1/13C12P7/64C12R1/89
CPCC12N9/1029C12P7/6463C12Y203/01158
Inventor 辛一徐健
Owner QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com