Detection method and application of gene transcription product
A detection method and gene transcription technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problem of less research on the function of circRNA, and achieve improved identification ability and high forensic application value Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1 Establishment of Messenger RNA and Circular RNA Method for Simultaneously Detecting the Transcription of the Same Gene
[0045] (1) Determination of common regions of messenger RNA and circular RNA of ALAS2 and MMP7
[0046] First, the exon structures of ALAS2 and MMP7 were determined by bioinformatics methods (such as figure 1 shown), a series of outward-facing primers were designed according to the exon sequences of ALAS2 and MMP7 for polymerase chain reaction. Total RNA in peripheral blood and menstrual blood was extracted by conventional kits and quantified using a UV spectrophotometer. The total RNAs were reverse-transcribed using the random primers included in the kit to obtain cDNA, which was used as a template for polymerase chain reaction. The amplified products were separated by agarose gel, and the amplified products were recovered by a DNA purification kit. The recovered amplified product was connected to the T vector, and the position of the 3'...
Embodiment 2
[0051] Example 2 Application of Messenger RNA and Circular RNA Method for Simultaneously Detecting the Transcription of the Same Gene
[0052] We first investigated the sensitivity of mRNA and circRNA methods for simultaneous detection of transcription of the same gene for gene expression detection, using primers reported in the literature as controls. The ALAS2 primers reported in the literature (Forensic Sci Int Genet.2011;5(5):449-58) are forward: TGTGTCCGTCTGGTGTAGTA, reverse: AAACTTACTGGTGCCTGAGA. The MMP7 primers reported in the literature (Forensic Sci Int Genet. 2012; 6(5):565-77) are forward: GAACAGGCTCAGGACTATCTC, reverse: TAACATTCCAGTTATAGGTAGGCC.
[0053] First, the sensitivity study was carried out by serial dilution method. The concentration gradient series of total RNA from peripheral blood and menstrual blood ranged from 0.2ng to 0.003ng. The RNA of each concentration was reversed into cDNA by random primers for use. The 5' end of one primer in each pair of pr...
Embodiment 3
[0062] Example 3 Detection and identification of biological samples by multiple amplification method
[0063] Simultaneously amplifying multiple target sites in a PCR system not only increases the amount of information in a single detection, but also reduces the amount of test materials used. The present invention simultaneously detects ALAS2, MMP7 and 18S rRNA in a PCR system, and constructs a composite amplification of 3 genes to identify biological samples, wherein 18S rRNA is used as an internal standard, ALAS2 is used as a specific biological marker of peripheral blood, and MMP7 is used as a menstrual blood marker. For blood biomarkers, in the same PCR system, the final concentrations of primers are shown in Table 3.
[0064] The concentration of each primer in the multiplex amplification of table 3
[0065]
[0066] The PCR reaction conditions are: 94°C / 5 minutes→28 cycles (94°C / 30 seconds, 58°C / 30 seconds, 72°C / 40 seconds)→72°C / 10 minutes→4°C hold.
[0067] The pol...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


