A kit for detecting bladder cancer based on high-throughput sequencing technology

A technology for detecting bladder cancer, applied in the field of kits for detecting bladder cancer based on high-throughput sequencing technology, can solve the problems of unreachable, reduced specificity, no statistical significance, etc., and achieves convenient sampling, high accuracy, Pain relief for patients

Active Publication Date: 2021-08-24
王煜
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2016, Qu Zhiyi et al. showed that the positive rate and sensitivity of FISH detection were 77.0% and 82.02%, respectively. The sensitivity and total positive rate of FISH detection were slightly higher than those of urine exfoliated cell detection, but the difference in specificity was not statistically significant.
However, this method is an invasive examination, which can lead to complications such as urinary tract infection, urethral bladder injury, etc. The cost is high and it is easy to miss the diagnosis of small tumors
[0005] Urine exfoliation cytology is a non-invasive diagnostic method for bladder cancer. Although it has high specificity, it has low sensitivity (13%-75%), especially for low-grade tumors.
[0006] Other non-invasive diagnostic methods such as fluorescence in situ hybridization (FISH), urine nuclear matrix protein 22 (Nuclear matrix protein 22, NMP22), bladder tumor antigen (bladder tumor antigen, BTA), etc., are slightly less sensitive than urine exfoliated cytology. Increased (70~80%), low stage (Ta, T1), lower sensitivity to low-grade tumors, and lower specificity, all of which have not reached the ideal level for clinical needs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kit for detecting bladder cancer based on high-throughput sequencing technology
  • A kit for detecting bladder cancer based on high-throughput sequencing technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Design of primers and adapters

[0023] 1.1 Design of specific primers for multiplex PCR

[0024] The bladder cancer mutation genes include PIK3CB, PIK3CA, FBXW7, FGFR3, NFE2L2, SF3B1, NRAS, EIF2AK3, TERT, CDKN1A, PRKAA1, ARID1A, APC, EGFR, ELF3, CTNNB1, ACTB, mTOR, IDH1.

[0025]The specific primers of the ACTB are SEQ ID NO.21 and SEQ ID NO.53, SEQ ID NO.26 and SEQ ID NO.58; the specific primers of the APC are SEQ ID NO.17 and SEQ ID NO.49 The specific primers of ARID1A are SEQ ID NO.16 and SEQ ID NO.48, SEQ ID NO.23 and SEQ ID NO.55; the specific primers of CDKN1A are SEQ ID NO.13 and SEQ ID NO 45. SEQ ID NO.29 and SEQ ID NO.61; the specific primers for CTNNB1 are SEQ ID NO.20 and SEQ ID NO.52; the specific primers for EGFR are SEQ ID NO.18 and SEQ ID NO.18 ID NO.40, SEQ ID NO.25 and SEQ ID NO.57, SEQ ID NO.28 and SEQ ID NO.60; the specific primers of the EIF2AK3 are SEQ ID NO.9 and SEQ ID NO.41; the The specific primers of ELF3 are SEQ ID NO.19 and SEQ ...

Embodiment 2

[0031] Example 2 Construction of high-throughput sequencing library

[0032] In this embodiment, the adapter element universal primers P5 and P7 are used, the sequences of which are respectively SEQ ID NO.65 and SEQ ID NO.66, and the adapter element adopts a protruding terminal adapter, which is a double-stranded nucleic acid molecule, and the double-stranded nucleic acid molecule At least one protruding end is included, 8 adapters are selected (that is, 8 samples are detected at the same time), the short chain sequence is SEQ ID NO.67, and the long chain sequence is SEQ ID NO.68-SEQ ID NO.75. The sequences of SEQ ID NO.65-SEQ ID NO.75 are shown in the table below:

[0033] serial number sequence SEQ ID NO.65 aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct SEQ ID NO.66 caagcagaagacggcatacga SEQ ID NO.67 attggcgctcttccgatct SEQ ID NO.68 gatcggaagagcacacgtctgaactccagtcacatcacgnnnnatctcgtatgccgtcttctgcttg SEQ ID NO.69 gatc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to a kit for detecting bladder cancer based on high-throughput sequencing technology, which includes multiple PCR-specific primers and linker elements for bladder cancer mutation genes shown in SEQ ID NO.1 to SEQ ID NO.64. The kit of the present invention can simultaneously amplify multiple bladder cancer mutation gene sites through urine nucleic acid to construct a sequencing library, and analyze the risk of bladder cancer of the subject through high-throughput sequencing and biological information, with convenient sampling and high accuracy. And it is non-invasive, which reduces the suffering of patients.

Description

technical field [0001] The invention relates to the field of gene detection, and more specifically, to a kit for detecting bladder cancer based on high-throughput sequencing technology. Background technique [0002] Bladder cancer is one of the most common malignant tumors in the genitourinary system. Cystoscopy is regarded as the gold standard for the diagnosis of bladder cancer. However, cystoscopy will bring many negative effects, such as urinary tract infection, urinary Fluid tract injury, bladder injury. Urine exfoliation cytology is another conventional method for the diagnosis of bladder cancer. Its advantages are non-invasive, high specificity and non-invasiveness, and overcomes the shortcomings of bladder endoscopy, but its detection rate is limited by many. Influenced by these factors, the sensitivity of urine exfoliative cytology to detect bladder cancer is 13% to 75%, and the specificity is 85% to 100%. The sensitivity is closely related to the tumor cell grade....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6886C12Q1/6806C12Q1/6869
CPCC12Q1/6806C12Q1/6869C12Q1/6886C12Q2600/156C12Q2600/16C12Q2531/113C12Q2537/143C12Q2525/191C12Q2535/122
Inventor王煜罗喜鹏王龙张青李佩周甘霖
Owner王煜