Quality detection method of Dendrobium loddigesii Rolfe

A quality inspection method and technology of Dendrobium candidum, applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve problems such as the inability to fully reflect the overall curative effect, achieve strong interpretation pertinence and applicability, effectively identify and control quality, and achieve The effect of correlation analysis

Active Publication Date: 2018-08-14
北京蓝标一成科技有限公司
View PDF8 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In traditional Chinese medicine under the guidance of traditional Chinese medicine theory, any ac

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quality detection method of Dendrobium loddigesii Rolfe
  • Quality detection method of Dendrobium loddigesii Rolfe
  • Quality detection method of Dendrobium loddigesii Rolfe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] The generation sequencing of embodiment 1 American flower dendrobium

[0053] First-generation sequencing primer sequences:

[0054] ITS-26SE: 5'GAATTCCCCGGTTCGCTCGCCGTTAC 3';

[0055] ITS-17SE: 5' ACGAATTCATGGTCCGGTGAAGTGTTCG 3'.

[0056] The amplification and sequencing parameters are: denaturation at 98°C for 2 minutes and then PCR cycle, the PCR cycle parameters are 98°C for 20s; 52°C for 30s; 68°C for 1min, 38 cycles, 68°C for 7min, set 4°C after the amplification, and perform Generation Molecular Sequencing.

[0057] Through the first-generation sequencing, the species of Dendrobium to be tested was identified as Dendrobium meihua.

Embodiment 2

[0058] The extraction method of embodiment 2 American flower dendrobium

[0059] Take the dried sample of Dendrobium candidum, pulverize it with a pulverizer, pass through a pharmacopoeia sieve (aperture 0.335mm), accurately weigh 1.000g of Dendrobium powder (the weighing error cannot exceed 0.2%), place it in a 100ml conical flask, and add 50mL of 75 % methanol (V water: V methanol = 25:75), take it out after ultrasonication for 30 minutes at room temperature, filter, and concentrate the filtrate to dryness by rotary evaporation, dissolve it with 75% methanol solvent (V water: V methanol = 25:75), and finally transfer Dilute to a 10ml volumetric flask, shake well, and filter with a 0.45 μm microporous membrane to obtain a sample solution of Dendrobium candidum.

Embodiment 3

[0060] The chromatographic detection method of the Dendrobium officinale extract of embodiment 3

[0061] ①Preparation of reference solution

[0062] Accurately weigh 4.10 mg of Schaftoside and 4.08 mg of naringenin, place them in 10 ml volumetric flasks, add 75% (V / V) methanol to dissolve and dilute, shake well, and use them as stock solutions. Refrigerate at 4°C for later use.

[0063] Then accurately draw a certain amount of reference substance stock solution and dilute with 75% methanol to accurately prepare a mixed reference substance solution of schaffertoside and naringenin. Through different dilution ratios, 7 concentration points of the prepared components were diluted. into a high performance liquid chromatograph.

[0064] ②Extraction and processing method of samples for determination of small molecule components in Dendrobium meihua:

[0065] Take 1.00g of the powder of this product (passed through a No. 3 sieve), accurately weigh it, put it in a 100ml volumetri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a quality detection method of Dendrobium loddigesii Rolfe. The quality detection method comprises: 1) sequencing by using ITS-26SE and ITS-17SE as primers to identify the variety of a to-be-detected Dendrobium; 2) carrying out chromatographic detection on n samples to obtain detection data using a chemical small molecule component schaftoside and/or naringenin as a reference component; 3) respectively carrying out fingerprint detection on the samples to obtain the fingerprint peak area value of the full chemical components of Dendrobium loddigesii Rolfe; and 4) establishing an analysis model by using the content value of the schaftoside and/or naringenin in the chromatographic data as the response variable and using the peak area value of other components in the fingerprint as the independent variable, screening the variable through a Lasso method, and establishing the fingerprint model related to the chemical small molecule component. According to the present invention, through the first-generation sequencing and the characteristic fingerprinting, the quality of Dendrobium loddigesii Rolfe is precisely identified and controlled.

Description

technical field [0001] The invention belongs to the field of detection and analysis of traditional Chinese medicine ingredients, and in particular relates to a quality detection method of Dendrobium candidum. Background technique [0002] Dendrobium loddigesii Rolfe.: Also known as Dendrobium Huancao and Dendrobium Panlong. Stems are weak, often drooping, slender cylindrical, 10cm-30cm long, 0.2cm-0.4cm in diameter, sometimes branched, with many nodes, internodes 1.5cm-2cm long, golden yellow when dry; leaf base with sheath, leaf sheath membrane Quality, the sheath mouth often open after drying. Racemes lateral to the upper part of the old stem with leaves, with 1 to 2 flowers; the peduncle of the inflorescence is 0.2cm to 0.3cm long, with 1 to 2 short, cup-shaped membranous sheaths at the base; the flowers are white or purple Red; bracts membranous, ovate, 0.2cm long, apex obtuse; pedicel and ovary light green, 2cm-3cm long; middle sepals ovate-oblong, 1.7cm-2cm long, 0.6...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): G01N30/02
CPCG01N30/02
Inventor 赵田邹婷婷
Owner 北京蓝标一成科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap