Unlock instant, AI-driven research and patent intelligence for your innovation.

A lentiviral expression vector with low expression of hepatocyte mir-199b and its construction method

A technology of mir-199b and tudmirna-199b, which is applied in the field of lentiviral expression vector and its construction with low expression of miR-199b in hepatocytes, to achieve good stability, high transfection efficiency and high efficiency

Active Publication Date: 2019-11-26
SHENZHEN CENT FOR DISEASE CONTROL & PREVENTION
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] By regulating the expression of miRNA-199b, it may play a role in the development of drugs for the treatment of diseases related to abnormal expression of miRNA-199b, but the existing technology can still stabilize the recombinant vector with low expression of miRNA-199b

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A lentiviral expression vector with low expression of hepatocyte mir-199b and its construction method
  • A lentiviral expression vector with low expression of hepatocyte mir-199b and its construction method
  • A lentiviral expression vector with low expression of hepatocyte mir-199b and its construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment one tudmiRNA-199b sequence

[0026] The reverse complementary sequence tudmiRNA-199b of the miRNA-199b gene associated with the SET gene was found through the miRBase library, and Hind III and Bgl II specific enzyme cutting sites were introduced, and the sequence of tudmiRNA-199b was designed as: GGATCCGGTGGCGCTAGGATCATCAACCCCAGTGTTTAGAATCTCTATCTGTTCCAAGTATTCTGGTCACAGAATACACCCCAGTGTTTAGAATCTCTATCTGTTCCAAGATG : 1, the sequence was synthesized by Shanghai Sangon Biological Company.

Embodiment 2

[0027] The acquisition of embodiment two tudmiRNA-199b recombinant plasmids

[0028] The pLVX-shRNA2 expression vector (spectrum as shown in figure 2 Shown) and the tudmiRNA-199b sequence obtained in Example 1 were double-digested with Hind III and Bgl II restriction endonucleases respectively, and ligated with T4 DNA ligase to obtain the ligation product. The ligation product was transformed into competent Escherichia coli JM 109, spread evenly on the LB medium plate containing ampicillin, picked positive monoclonal colonies, cultured and preserved the bacterial liquid, and carried out preliminary PCR identification, the gel after PCR amplification Electropherogram as figure 1 As shown, the result shows that the PCR identification result of the colony is positive, which can be used to pick up the plasmid for expansion culture. The preliminary identification results show that the tudmiRNA-199b sequence was successfully inserted into the bacteria liquid for sequencing identifi...

Embodiment 3

[0029] Example 3 Lentiviral expression vector with low expression of miR-199b in liver cells

[0030] After the pLVX-shRNA2-puro virus vector and the tudmiRNA-199b recombinant plasmid containing the tudmiRNA-199b sequence obtained in Example 2 were double-digested with Hind III and BamH I restriction endonucleases, T4 DNA ligase was ligated to obtain a ligation product. Transform the ligation product into competent Escherichia coli JM 109, evenly spread it on the LB medium plate containing ampicillin, pick the positive monoclonal colony, culture and save the bacterial liquid, and carry out sequencing identification, and culture the Escherichia coli with correct sequencing identification. , and use the Endo-free Plasmid Maxi Kit for extraction to obtain a lentiviral expression vector with low expression of miR-199b in hepatocytes.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a lentiviral expression vector capable of lowering expression of miR-199b in liver cells. The lentiviral expression vector includes: a basic sequence of a pLVX-shRNA2-puro virusvector, a resistant gene sequence, a polyclonal locus sequence, a promoter sequence, and a tudmiRNA-199b recombinant plasmid, wherein the polyclonal locus sequence includes a Hind III restriction enzyme cutting site and a BamH I restriction enzyme cutting site; the tudmiRNA-199b recombinant plasmid is forwardly inserted into the polyclonal locus sequence. The invention belongs to the technical field of gene engineering. The recombinant lentiviral expression vector has high transfection efficiency and is low in use amount, and can durably, high-effectively and stably inhibit expression of themiRNA-199b in human-sourced liver cells.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a lentiviral expression vector with low expression of miR-199b in liver cells and a construction method thereof. Background technique [0002] miRNA is a class of evolutionarily conserved endogenous non-coding small molecules that are ubiquitous in diverse organisms and participate in gene regulation. miRNA mainly regulates the expression of genes encoding proteins, and its mechanism of action is to degrade its complementary mRNA or inhibit the translation of incompletely paired mRNA, which plays a very important biological role. [0003] miRNA is transcribed from DNA into primary miRNA (pri-miRNA) under the action of DNA polymerase II in the nucleus. miRNA is processed and sheared into a hairpin precursor pre-miRNA with a sequence of sixty to seventy nucleotides under the action of the nuclear enzyme RNaseⅢ-Drosha, and then depends on the RNA-dependent n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/867C12N15/66
CPCC12N15/66C12N15/86C12N2740/15043
Inventor 刘建军任晓虎阮嘉雯刘威黄新凤
Owner SHENZHEN CENT FOR DISEASE CONTROL & PREVENTION