A lentiviral expression vector with low expression of hepatocyte mir-199b and its construction method
A technology of mir-199b and tudmirna-199b, which is applied in the field of lentiviral expression vector and its construction with low expression of miR-199b in hepatocytes, to achieve good stability, high transfection efficiency and high efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Embodiment one tudmiRNA-199b sequence
[0026] The reverse complementary sequence tudmiRNA-199b of the miRNA-199b gene associated with the SET gene was found through the miRBase library, and Hind III and Bgl II specific enzyme cutting sites were introduced, and the sequence of tudmiRNA-199b was designed as: GGATCCGGTGGCGCTAGGATCATCAACCCCAGTGTTTAGAATCTCTATCTGTTCCAAGTATTCTGGTCACAGAATACACCCCAGTGTTTAGAATCTCTATCTGTTCCAAGATG : 1, the sequence was synthesized by Shanghai Sangon Biological Company.
Embodiment 2
[0027] The acquisition of embodiment two tudmiRNA-199b recombinant plasmids
[0028] The pLVX-shRNA2 expression vector (spectrum as shown in figure 2 Shown) and the tudmiRNA-199b sequence obtained in Example 1 were double-digested with Hind III and Bgl II restriction endonucleases respectively, and ligated with T4 DNA ligase to obtain the ligation product. The ligation product was transformed into competent Escherichia coli JM 109, spread evenly on the LB medium plate containing ampicillin, picked positive monoclonal colonies, cultured and preserved the bacterial liquid, and carried out preliminary PCR identification, the gel after PCR amplification Electropherogram as figure 1 As shown, the result shows that the PCR identification result of the colony is positive, which can be used to pick up the plasmid for expansion culture. The preliminary identification results show that the tudmiRNA-199b sequence was successfully inserted into the bacteria liquid for sequencing identifi...
Embodiment 3
[0029] Example 3 Lentiviral expression vector with low expression of miR-199b in liver cells
[0030] After the pLVX-shRNA2-puro virus vector and the tudmiRNA-199b recombinant plasmid containing the tudmiRNA-199b sequence obtained in Example 2 were double-digested with Hind III and BamH I restriction endonucleases, T4 DNA ligase was ligated to obtain a ligation product. Transform the ligation product into competent Escherichia coli JM 109, evenly spread it on the LB medium plate containing ampicillin, pick the positive monoclonal colony, culture and save the bacterial liquid, and carry out sequencing identification, and culture the Escherichia coli with correct sequencing identification. , and use the Endo-free Plasmid Maxi Kit for extraction to obtain a lentiviral expression vector with low expression of miR-199b in hepatocytes.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


