Specific primer and rapid detecting method for detecting lasiodiplodia theobromae

A detection method and cocoa ball technology, applied in the field of microbial detection, can solve the problems of long time, cumbersome procedures, delays, etc., and achieve the effects of good specificity, high sensitivity, economy and short time consumption.

Active Publication Date: 2018-09-14
ENVIRONMENT & PLANT PROTECTION INST CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The above two classification methods of pathogenic bacteria are time-consuming and cumbersome, and often lead to misdiagnosis of diseases and delays in prevention and control
Therefore, the conventional disease diagnosis technology based on disease symptoms cannot achieve the detection before the disease occurs, it is difficult to implement early prevention and control, and it is not suitable for the requirements of rapid detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer and rapid detecting method for detecting lasiodiplodia theobromae
  • Specific primer and rapid detecting method for detecting lasiodiplodia theobromae
  • Specific primer and rapid detecting method for detecting lasiodiplodia theobromae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1, specific primer design

[0032]According to the translation elongation factor gene (Transcription elongation factor, TEF) sequence of Botryobacteriaceae fungi including Lasiodiplodia theobromae and other species of fungi in GenBank, a variation interval that can be used to design L. theobromae-specific primers was found. The sequence is acgcatgtcgttttttaacccctctcga (i.e. SEQ ID NO: 1), the upstream primer ZYLTF1 for L.theobromae detection is designed using this interval sequence, and the downstream primer ZYLTR1 for L.theobromae detection is designed according to other base sequences of the translation elongation factor, which The nucleotide sequence is:

[0033] (SEQ ID NO: 2) ZYLTF1: 5'-acgcatgtcgttttttaa-3';

[0034] (SEQ ID NO:3) ZYLTR1: 5'-tacatgagtggtcagagcat-3'.

Embodiment 2

[0035] Example 2, a molecular detection method for rapid detection of phytopathogenic fungus Dispora coccidioides

[0036] 2.1 Test strains

[0037] Lasiodiplodia theobromae isolated from mango (strain LTMG1), L. theobromae isolated from mango (strain LTMG9), L. theobromae isolated from longan (strain LTLY13), L. theobromae isolated from longan (strain LTLY25), L. theobromae isolated from kiwi (strain MHT5), isolated from grape L. theobromae (strain LTPT2), isolated from cherry L. theobromae (strain LTYT42), isolated from bayberry L. theobromae (strain LTYM6), isolated from guava L. theobromae (strain LTFSL9), L. theobromae (strain LTXJ57) isolated from banana.

[0038] L.pseudotheobromae、L.crassispora、Neofusicoccum mangiferae、N.parvum、Botryosphaeria dothidea、Colletotrichum scovillei、Mortierella minutissima、Penicillium urticae、Acremonium furcatum、Truncatella angustata、Aspergillussydowii、Alternaria alternata、Phyllosticta capitalensis、Stemphyliumlycopersici、Pestalotiopsis mangi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specific primer and a variation interval, wherein the specific primer is used for rapidly detecting pathogenic bacterium lasiodiplodia theobromae causing various plant diseases, and the variation interval is used for designing the specific primer. The variation interval for designing an L.theobromae specific primer is discovered according to transcription elongation factor (TEF) sequences of botryosphaeria dothidea fungi and other fungi comprising the lasiodiplodia theobromae in a GenBank, a high-specificity primer pair ZYLTF1 / ZYLTR1 is designed based on an interval sequence and can specifically amplify a 216bp stripe only from L.theobromae, and any stripes can not be amplified from other species. The invention further provides a rapid detecting method of the primer pair for the lasiodiplodia theobromae. The rapid detecting method has the advantages of good specificity, high sensitivity, economy, rapidness and the like, the method can rapidly and accurately detect whether the L.theobromae exists or not, and the method can play a pivotal role in early prevention and control of plant diseases.

Description

technical field [0001] The invention relates to the technical field of microbial detection, in particular to a specific primer and a rapid detection method for detecting Dispora cacao. Background technique [0002] Lasiodiplodia theobromae grows fast, has strong spreading ability, and has strong adaptability to the environment. It can grow in the range of pH 4-9 and temperature 10-37°C. The pathogen has a wide range of hosts and can cause longan, kiwi, mango, chestnut and other fruits to rot. plant diseases. [0003] Rapid identification of plant diseases is the key to early control. The traditional method of diagnosing plant diseases can only determine the pathogen by separating and purifying the pathogenic bacteria and identifying the pathogenic bacteria after the plants show symptoms of the disease. At the same time, after the isolation of pathogenic bacteria, it is necessary to carry out morphological or molecular identification of the pathogenic bacteria in order to ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/04C12N15/11C12R1/645
CPCC12Q1/6895
Inventor周游黄俊生杨腊英汪军郭立佳刘磊梁昌聪
OwnerENVIRONMENT & PLANT PROTECTION INST CHINESE ACADEMY OF TROPICAL AGRI SCI