Salmonella choleraesuis C500 strain having deletion of asd and realizing expression of lacI
A technology of Salmonella swine and pre112-asd, applied in the biological field, can solve the problems of affecting the stability of the host bacteria and affecting the immune effect, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1A
[0060] Construction of embodiment 1 Asd deletion suicide plasmid
[0061] 1. Extraction of C500 genome
[0062] The extraction of Salmonella choleraesuis C500 genomic DNA was carried out according to the instructions of the trace bacterial genome extraction kit.
[0063] 2. Amplify the upstream and downstream fragments of asd in the C500 genome
[0064] 1) Synthesis of primers
[0065] Asd-F1: CGTCGTCCTACCTTCAGG
[0066] Asd-F2: GAGCTCGGTACCAGCCTGCAGTCTAGAGTAGTGGCTATTGCAGCGC
[0067] Asd-R1: TCTAGACTGCAGGCTGGTACCGAGCTCCCTGCAAAGAGATGTGCTGT
[0068] Asd-R2: GCATGGCAATCGCCCAACG;
[0069] 2) Amplification of target genes PCR1 (upstream) and PCR2 (downstream)
[0070] a.PCR1 reaction system is as follows:
[0071]
[0072] The PCR1 reaction conditions are as follows:
[0073]
[0074] b. PCR2 reaction system is as follows:
[0075]
[0076] The PCR1 reaction conditions are as follows:
[0077]
[0078] c.PCR results electrophoresis as shown in figure 1 shown...
Embodiment 2
[0106] Embodiment 2 carries araCP BAD - lacI Construction of the suicide plasmid
[0107] 1. Target gene araCP BAD - lacI Amplification of
[0108] 1) Design and synthesis of primers
[0109] araC-KpnI-F: ataGGTACCTGATTACTGTCTGGGGTG
[0110] lacI-xbaI-R: tatTCTAGAGAATTCCCGGGAGAGCTC
[0111] 2) Target gene araCP BAD -PCR amplification of LacI (SEQ ID No.2)
[0112] a. The PCR reaction system is as follows:
[0113]
[0114] b. PCR reaction conditions are as follows:
[0115]
[0116] C.PCR results electrophoresis as shown Figure 5 shown;
[0117] d. Recovery of PCR products
[0118] PCR products were gel-recovered using a DNA gel recovery kit.
[0119] 2. Carry out double enzyme digestion of the gel recovery products
[0120] a. Enzyme digestion system is as follows:
[0121]
[0122] Digest overnight at 37°C.
[0123] b. Use the DNA purification and recovery kit to recover and purify the digested product.
[0124] 3. Carrier pRE112-asd plasmid doub...
Embodiment 3
[0145] Example 3 Salmonella choleraesuis C500 strain (C500Δasd::araCP) with deletion of asd and expression of lacI BAD - lacI ) homologous recombination construction process
[0146] 1. On Day1, pick χ7213 (pRE112-asd-araCP) at night BAD -lacI) Inoculate a single colony into 5ml LB liquid medium containing chloramphenicol and 50ug / ml DAP, inoculate C500 into 5ml LB medium, and shake overnight at 37°C;
[0147] 2. On Day 2, take 1ml of χ7213 (pRE112-asd-lacI), centrifuge at 5000rpm for 5min, discard the supernatant, add 500ulC500, mix well, place in LB solid medium containing 50ug / ml DAP, and place it upright overnight at 37°C to make χ7213 and The conjugation of C500 bacteria occurs through pili, and homologous recombination occurs with the genome of C500 after the suicide plasmid is transferred into C500;
[0148] 3. On Day 3, pick bacteria and streak them on XLD solid medium containing 25ug / ml chloramphenicol, culture overnight at 37°C; XLD medium can selectively separat...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap