Salmonella choleraesuis C500 strain having deletion of asd and realizing expression of lacI

A technology of Salmonella swine and pre112-asd, applied in the biological field, can solve the problems of affecting the stability of the host bacteria and affecting the immune effect, etc.

Inactive Publication Date: 2018-09-28
JILIN AGRICULTURAL UNIV
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to solve the problem that exogenous antigens affect the stability of host bacteria and cause

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Salmonella choleraesuis C500 strain having deletion of asd and realizing expression of lacI
  • Salmonella choleraesuis C500 strain having deletion of asd and realizing expression of lacI
  • Salmonella choleraesuis C500 strain having deletion of asd and realizing expression of lacI

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1A

[0060] Construction of embodiment 1 Asd deletion suicide plasmid

[0061] 1. Extraction of C500 genome

[0062] The extraction of Salmonella choleraesuis C500 genomic DNA was carried out according to the instructions of the trace bacterial genome extraction kit.

[0063] 2. Amplify the upstream and downstream fragments of asd in the C500 genome

[0064] 1) Synthesis of primers

[0065] Asd-F1: CGTCGTCCTACCTTCAGG

[0066] Asd-F2: GAGCTCGGTACCAGCCTGCAGTCTAGAGTAGTGGCTATTGCAGCGC

[0067] Asd-R1: TCTAGACTGCAGGCTGGTACCGAGCTCCCTGCAAAGAGATGTGCTGT

[0068] Asd-R2: GCATGGCAATCGCCCAACG;

[0069] 2) Amplification of target genes PCR1 (upstream) and PCR2 (downstream)

[0070] a.PCR1 reaction system is as follows:

[0071]

[0072] The PCR1 reaction conditions are as follows:

[0073]

[0074] b. PCR2 reaction system is as follows:

[0075]

[0076] The PCR1 reaction conditions are as follows:

[0077]

[0078] c.PCR results electrophoresis as shown in figure 1 shown...

Embodiment 2

[0106] Embodiment 2 carries araCP BAD - lacI Construction of the suicide plasmid

[0107] 1. Target gene araCP BAD - lacI Amplification of

[0108] 1) Design and synthesis of primers

[0109] araC-KpnI-F: ataGGTACCTGATTACTGTCTGGGGTG

[0110] lacI-xbaI-R: tatTCTAGAGAATTCCCGGGAGAGCTC

[0111] 2) Target gene araCP BAD -PCR amplification of LacI (SEQ ID No.2)

[0112] a. The PCR reaction system is as follows:

[0113]

[0114] b. PCR reaction conditions are as follows:

[0115]

[0116] C.PCR results electrophoresis as shown Figure 5 shown;

[0117] d. Recovery of PCR products

[0118] PCR products were gel-recovered using a DNA gel recovery kit.

[0119] 2. Carry out double enzyme digestion of the gel recovery products

[0120] a. Enzyme digestion system is as follows:

[0121]

[0122] Digest overnight at 37°C.

[0123] b. Use the DNA purification and recovery kit to recover and purify the digested product.

[0124] 3. Carrier pRE112-asd plasmid doub...

Embodiment 3

[0145] Example 3 Salmonella choleraesuis C500 strain (C500Δasd::araCP) with deletion of asd and expression of lacI BAD - lacI ) homologous recombination construction process

[0146] 1. On Day1, pick χ7213 (pRE112-asd-araCP) at night BAD -lacI) Inoculate a single colony into 5ml LB liquid medium containing chloramphenicol and 50ug / ml DAP, inoculate C500 into 5ml LB medium, and shake overnight at 37°C;

[0147] 2. On Day 2, take 1ml of χ7213 (pRE112-asd-lacI), centrifuge at 5000rpm for 5min, discard the supernatant, add 500ulC500, mix well, place in LB solid medium containing 50ug / ml DAP, and place it upright overnight at 37°C to make χ7213 and The conjugation of C500 bacteria occurs through pili, and homologous recombination occurs with the genome of C500 after the suicide plasmid is transferred into C500;

[0148] 3. On Day 3, pick bacteria and streak them on XLD solid medium containing 25ug / ml chloramphenicol, culture overnight at 37°C; XLD medium can selectively separat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a salmonella choleraesuis C500 strain having deletion of asd and realizing expression of lacI. According to the salmonella choleraesuis C500 strain, the salmonella choleraesuisC500 strain is adopted as the carrier, gene modification is carried out on the chromosomes of the salmonella choleraesuis C500 strain, so that the asd gene of the salmonella choleraesuis C500 has deletion, the salmonella choleraesuis C500 delta asd deletion strain is constructed, meanwhile, the araC PBAD-lacI sequence is placed in the deleted asd gene reading frame, so that while the C500 strainhas the deletion of the asd gene, the araC PBAD-lacI expression cassette is introduced, and the LacI protein can be expressed while arabinose exists; in addition, an EGFP expression plasmid pYA4514-EGFP containing the Ptrc promoter is constructed, and the negative regulation effect of LacI for the Ptrc promoter is detected through the western blot experiment. The invention provides the brand-new C500 strain realizing the regulatable expression of the exogenous antigenic gene based on a balanced-lethal system and the expression plasmid, and a foundation is laid for the expression of the exogenous antigenic component by utilizing the C500 strain in the future.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a Salmonella choleraesuis C500 strain which lacks asd and expresses lacI. Background technique [0002] Salmonellosis, also known as paratyphoid fever, is a general term for animal diseases caused by bacteria of the genus Salmonella. Salmonella choleraesuis is one of the main pathogens causing paratyphoid fever in month-old piglets. This pathogen can cause a large number of weaned piglets to become sick, showing different clinical reactions , including sepsis and local inflammation of other tissues, can also cause abortion of pregnant dams leading to acute epidemic outbreaks, which play an important role in the breeding industry. Salmonella is a Gram-negative, motile, non-spore-forming, facultatively anaerobic, flagella-like organism. The optimum growth temperature is 37°C, and the optimum pH is 6.8~7.8. Salmonella has tenacious vitality, strong resistance to the outside world, and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/74C12N1/21C12N15/66C12R1/42
CPCC12N15/66C12N15/74
Inventor 姜延龙王春凤杨桂连高兴张洁
Owner JILIN AGRICULTURAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap