Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of micro-RNA marker and its application

A marker and tiny technology, applied in the field of biomedical testing, can solve problems such as poor diagnosis and prognosis of CTEPH, and achieve good tissue specificity and improve sensitivity and specificity.

Active Publication Date: 2019-05-17
BEIJING CHAOYANG HOSPITAL CAPITAL MEDICAL UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

With the current state of medical technology, CTEPH is still a disease that is difficult to diagnose and has a poor prognosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of micro-RNA marker and its application
  • A kind of micro-RNA marker and its application
  • A kind of micro-RNA marker and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Primer Design

[0026] According to the sequence of hsa-miR-20a-5p, primers and probe sequences were designed. The specific sequence is as follows:

[0027] The reverse transcription primer sequence SEQ ID No.2 of hsa-miR-20a-5p:

[0028] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTACCT;

[0029] The forward primer sequence SEQ ID No.3 of hsa-miR-20a-5p:

[0030] GCGCGCTAAAGTGCTTATAGTGC;

[0031] The reverse primer sequence SEQ ID No.4 of hsa-miR-20a-5p:

[0032] GTGCAGGGTCCGAGGT;

[0033] The forward primer sequence of U6 is SEQ ID No.5: CTCGCTTCGGCAGCACA;

[0034] The reverse primer sequence of U6 is SEQ ID No.6: AACGCTTCACGAATTTGCGT;

[0035] The above primers were synthesized by GenScript Biotechnology Co., Ltd.

Embodiment 2

[0036] Example 2 total RNA extraction

[0037] (1) Take the blood sample (which has been added with Biotech lysate) and let it stand on ice for 5 minutes.

[0038] (2) Add 200 μl of chloroform, vortex and mix well, then place at room temperature for 2-3 minutes. Centrifuge at 12,000 g for 15 min at 4°C.

[0039] (3) Absorb the upper aqueous phase into another centrifuge tube. NOTE: Never pipette the middle interface.

[0040] (4) Add an equal amount of isopropanol, mix well, and precipitate at -20°C.

[0041] (5) Centrifuge at 12,000g at 4°C for 10 minutes, discard the supernatant, and sink the RNA to the bottom of the tube.

[0042] (6) Add 1ml of 75% ethanol to suspend the precipitate.

[0043] (7) Centrifuge at 12,000 g for 5 min at 4°C, and discard the supernatant as much as possible.

[0044] (8) Air dry at room temperature or vacuum dry for 5-10min. Note: RNA samples should not be too dry, otherwise it will be difficult to dissolve.

[0045] (9) with 20μl DEPC H ...

Embodiment 3

[0047] Example 3 Prediction of miRNAs associated with CTEPH

[0048] Using bioinformatics analysis technology, 169 miRNA-target relationship pairs were predicted by miRWalk2.0 software, including 21 miRNAs, 3 up-regulated miRNAs, and 18 down-regulated miRNAs; the above predicted miRNA-target relationship pairs were used to construct a regulatory network Figure, miRNA-target regulatory network see figure 1 , a total of 147 nodes, see the specific results figure 1 . Among them, hsa-miR-20a-5p is a down-regulated miRNA associated with CTEPH disease.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a micro-RNA marker and application thereof to preparation of a product for the diagnosis of a chronic thromboembolic pulmonary hypertension CTEPH disease. The micro-RNA markeris hsa-miR-20a-5p. The invention further discloses a kit; the kit contains a reagent for determining the has-miR-20a-5p marker. The kit for chronic thromboembolic pulmonary hypertension CTEPH miRNA disease detection is quick and convenient and can realize the early diagnosis and the prediction of CTEPH.

Description

technical field [0001] The invention belongs to the field of biomedical testing, and relates to a microRNA marker for diagnosing chronic thromboembolic pulmonary hypertension (CTEPH), and also relates to the application of the marker in diagnosing CTEPH and a related kit. Background technique [0002] Chronic thromboembolic pulmonary hypertension (CTEPH) is a disease characterized by dyspnea, fatigue and reduced activity tolerance, mainly due to pulmonary artery thromboembolism with pulmonary vascular remodeling, leading to progressive increase in pulmonary vascular resistance It is a serious, progressive and fatal disease. It has been reported that after the occurrence of acute symptomatic pulmonary embolism, the two-year cumulative incidence of CTEPH is 0.1% to 9.1%. The reason for such a huge deviation in the incidence rate is due to the different judgment standards. At present, there is no data on the exact incidence rate of the population, and some data show that the in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12Q1/6883
CPCC12N15/113C12N2310/141C12Q1/6883C12Q2600/158C12Q2600/178
Inventor 缪冉杨媛华翟振国龚娟妮李积凤万钧邝土光杨苏乔李一丹刘敏
Owner BEIJING CHAOYANG HOSPITAL CAPITAL MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More