Supercharge Your Innovation With Domain-Expert AI Agents!

Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum antibody

A kit and protein technology, applied in the biological field, can solve the problems of inability to detect avian leukemia and pullorum at the same time, large manpower, consumption, etc., and achieve the effect of reducing the work of clinical detection and purification.

Active Publication Date: 2018-11-09
CHINA AGRI UNIV
View PDF10 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These kits or methods are only for the detection of a single infectious disease, and cannot detect avian leukemia and pullorum at the same time
[0011] Both avian leukemia and pullorum are infectious diseases that need to be purified in chicken farms. At present, the purification of avian leukemia is mainly to use foreign ELISA kits to detect the avian leukemia virus antigen p27 in the chicken cloacal swab and the avian leukemia antibody in the chicken serum. The purification of pullorum mainly uses plate agglutination test to detect the antibody of Salmonella pullorum in chicken serum. These kits or methods are all aimed at the detection of a single infectious disease. There is no single kit that can detect the two diseases of avian leukemia and pullorum
The kit for detecting avian leukosis alone and the method of plate agglutination test for detecting pullorum alone make the clinical detection and purification of pullorum and pullorum consume a lot of manpower, material resources and financial resources

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum antibody
  • Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum antibody
  • Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1p27

[0078] Preparation of embodiment 1p27 protein, gp85 protein and GroEL-Δ8-1 protein

[0079] (1) Construction of avian leukosis virus p27 prokaryotic expression vector and protein expression and purification

[0080]According to the sequence design of the p27 gene in the complete sequence (M37980) of the avian leukosis virus gene that has registered in Genbank, the specific primers with restriction sites: upstream primer (as shown in SEQ ID No.1) CGGGATCCATGCCTGTAGTGATTAAGAC, downstream primer (as shown in SEQ ID No.1) ID No.2) CGCTCGAGCTAGGGCTGGATAGCAGACG. The p27 gene fragment was amplified by PCR, and the p27 gene was inserted into pET-30a prokaryotic expression vector by enzyme-digesting and enzyme-linking method. Correctly sequenced pET-30a-p27 was transformed into Transetta (DE3). Culture pET-30a-p27 / Transetta(DE3) with shaking at 37°C until OD 600 0.6 to 0.8, add IPTG to make the final concentration 1mmol / L, induce expression at 37°C, 200rpm for 6h, and collect the ce...

Embodiment 2

[0084] Embodiment 2 Establishment of indirect ELISA detection method and determination of conditions

[0085] 2.1 Determination of optimal antigen coating conditions

[0086] First determine the ratio of p27+gp85 as p27:gp85 is 1:1, then the final concentration of p27+gp85 and GroEL-Δ8-1 protein is 0.25, 0.5, 1, 2, 4 and 8 μg / mL, and GroEL-Δ8- 1: The p27+gp85 protein ratio is 1:0.125, 1:0.25, 1:0.5, 1:1, 1:2, 1:4 and 1:8 different combinations of antigen coating conditions, and each antigen coating combination is used separately The coating solution was diluted and mixed with p27+gp85 and GroEL-Δ8-1 antigens to coat the microtiter plate, 100 μL / well. Each antigen coating combination detects the titer of pullorum-positive serum and avian leukosis-positive serum respectively, dilutes pullorum-positive serum and avian leukosis-positive serum with 0.5% BSA, and dilution is respectively 1:200, 1:400, 1: 800, 1:1600, 1:3200, 1:6400, 1:12800, 1:25600, 2 microplate replicates for ea...

Embodiment 3

[0146] Example 3 Detection of Pullorum Positive Serum and Avian Leukemia Positive Serum Mixed Sample

[0147] The pullorum positive serum and the avian leukosis positive serum were respectively 1:0, 100:1, 50:1, 20:1, 10:1, 1:1, 1:10, 1:20, 1:50, 1:1: Different ratios of 100 and 0:1 were mixed, and the optimized self-built Salmonella pullorum antibody ELISA detection method, the self-built avian leukosis virus antibody ELISA detection method, and the self-built Salmonella pullorum antibody and avian leukosis virus antibody ELISA were used respectively. The co-detection method detects the potency of different pooled sera.

[0148] Table 14 detects the titer results of different mixing ratios of SP-positive serum and ALV-positive serum with different coating antigens

[0149]

[0150] The results are consistent with expectations, as shown in Table 14, the titer of the serum detected by the single-detection ELISA method increases continuously with the proportion of the corres...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Dilution degreeaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of biology and in particular relates to a kit for simultaneously detecting an avian leukosis virus antibody and a salmonella pullorum antibody. An antigencombination of the kit comprises p27 protein, gp85 protein and GroEL-delta8-1 protein. Avian leukosis virus capsid protein p27, prokaryotic expression protein of envelope protein gp85, and prokaryoticexpression protein of truncated GroEL-delta8-1 of a salmonella pullorum dominant antigen are used as a coating antigen to develop an ELISA (Enzyme-linked Immunosorbent Assay) kit capable of simultaneously detecting the avian leukosis virus antibody and the salmonella pullorum antibody. Compared with a current common kit for independently detecting avian leukosis or pullorum disease, the kit provided by the invention has the effect of simultaneously detecting the avian leukosis or the pullorum disease, and the detection and purification work of the avian leukosis and the pullorum disease can be extremely alleviated.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a kit for simultaneous detection of antibodies to avian leukosis virus and Salmonella pullorum. Background technique [0002] Avian Leukosis is a general term for a variety of tumor diseases in poultry caused by viruses in the Avian Leukosis Virus (ALV) and Avian Sarcoma Virus (ASV) groups. The disease can cause many infectious benign and malignant tumors in chickens. [0003] Since Roloff reported chicken lymphosarcoma in 1868, avian leukemia has been distributed all over the world, and natural cases have also occurred in my country. The disease can cause slow weight gain, delayed sexual maturity, small eggs, thin eggshells, decreased egg production, low fertilization rate and hatchability, increased carcass waste rate, and increased mortality, causing direct economic losses. At the same time, it can also cause the body's non-specific resistance to decrease and immunosuppression, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/569G01N33/68
CPCG01N33/56916G01N33/56983G01N33/6893G01N2333/255G01N2333/465
Inventor 郑世军王永强游广炬李晓齐曹红
Owner CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More