Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum antibody
A kit and protein technology, applied in the biological field, can solve the problems of inability to detect avian leukemia and pullorum at the same time, large manpower, consumption, etc., and achieve the effect of reducing the work of clinical detection and purification.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1p27
[0078] Preparation of embodiment 1p27 protein, gp85 protein and GroEL-Δ8-1 protein
[0079] (1) Construction of avian leukosis virus p27 prokaryotic expression vector and protein expression and purification
[0080]According to the sequence design of the p27 gene in the complete sequence (M37980) of the avian leukosis virus gene that has registered in Genbank, the specific primers with restriction sites: upstream primer (as shown in SEQ ID No.1) CGGGATCCATGCCTGTAGTGATTAAGAC, downstream primer (as shown in SEQ ID No.1) ID No.2) CGCTCGAGCTAGGGCTGGATAGCAGACG. The p27 gene fragment was amplified by PCR, and the p27 gene was inserted into pET-30a prokaryotic expression vector by enzyme-digesting and enzyme-linking method. Correctly sequenced pET-30a-p27 was transformed into Transetta (DE3). Culture pET-30a-p27 / Transetta(DE3) with shaking at 37°C until OD 600 0.6 to 0.8, add IPTG to make the final concentration 1mmol / L, induce expression at 37°C, 200rpm for 6h, and collect the ce...
Embodiment 2
[0084] Embodiment 2 Establishment of indirect ELISA detection method and determination of conditions
[0085] 2.1 Determination of optimal antigen coating conditions
[0086] First determine the ratio of p27+gp85 as p27:gp85 is 1:1, then the final concentration of p27+gp85 and GroEL-Δ8-1 protein is 0.25, 0.5, 1, 2, 4 and 8 μg / mL, and GroEL-Δ8- 1: The p27+gp85 protein ratio is 1:0.125, 1:0.25, 1:0.5, 1:1, 1:2, 1:4 and 1:8 different combinations of antigen coating conditions, and each antigen coating combination is used separately The coating solution was diluted and mixed with p27+gp85 and GroEL-Δ8-1 antigens to coat the microtiter plate, 100 μL / well. Each antigen coating combination detects the titer of pullorum-positive serum and avian leukosis-positive serum respectively, dilutes pullorum-positive serum and avian leukosis-positive serum with 0.5% BSA, and dilution is respectively 1:200, 1:400, 1: 800, 1:1600, 1:3200, 1:6400, 1:12800, 1:25600, 2 microplate replicates for ea...
Embodiment 3
[0146] Example 3 Detection of Pullorum Positive Serum and Avian Leukemia Positive Serum Mixed Sample
[0147] The pullorum positive serum and the avian leukosis positive serum were respectively 1:0, 100:1, 50:1, 20:1, 10:1, 1:1, 1:10, 1:20, 1:50, 1:1: Different ratios of 100 and 0:1 were mixed, and the optimized self-built Salmonella pullorum antibody ELISA detection method, the self-built avian leukosis virus antibody ELISA detection method, and the self-built Salmonella pullorum antibody and avian leukosis virus antibody ELISA were used respectively. The co-detection method detects the potency of different pooled sera.
[0148] Table 14 detects the titer results of different mixing ratios of SP-positive serum and ALV-positive serum with different coating antigens
[0149]
[0150] The results are consistent with expectations, as shown in Table 14, the titer of the serum detected by the single-detection ELISA method increases continuously with the proportion of the corres...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Dilution degree | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


