Method for changing feeding habits of bombyx mori and application of method
A technology of silkworm and feeding habits, applied in genome editing and biological fields
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Embodiment 1, the cloning of hestia gene
[0050] The genome sequence of the target gene hestia is as follows (SEQ ID NO: 9, wherein the underlined sequence is an exon sequence, and the non-underlined sequence is an intron sequence):
[0051] ATGTCACCACCGCTAGTCCATATCAATACATTTGTTCAACCCAAGCAAAGTACACTGTAGACAAAAGTA TCAAAGTTTTTTATAATATGTAGTTTTTCTTAGGCGTTAATAGGTTGCCTATTATATCATCGAAACATGTGTATAC AATTCCTTCTATAATTTATACTTTCGTACTAATGTGTGTACTAAATTTTTTCGGGTTTGATTCTGTCTCATTATCTA TCATGAGTTTGAACCTTGTATTACATATCTTATGTTCCTTCCTTGGTATGTTTTTTTTGGAAGAGAATGCGCCTGTAT TATTCAGAGCTCTGTAAGTTTGATATTTGCATCGGATGCAGACCAATAACTGCACAAGGTTCCAGTAAACTTGTAAT TCAGACTTGCATTATAAATGTTTTGATAGCTTTGGTGTTTATTGTGCCGAATTCACTTCAGATTCTAATCAAACCAG TTATATATTTGCTTCCCATGCACGCCTTTGTGTCGTTCGAAGTGCATTATTATGGCCACCTTCTCAATTTACTTATC CCGCGTTTACATTTAATAAACTATTACATGGAATCCTCATTAACTACCACAAGCGATAAAAGGGAGTCGAGTGTACT GAAACATGTTATTTTTATTTAAATATTATAATAAGGAATCGAACTGTCAAATGAAAAAATTTATGGATCTTTATTATA TTATCGTAGAATTCTTACAGATATCTTA...
Embodiment 2
[0059] Embodiment 2, the selection of sgRNA target (TS) and the synthesis of sgRNA
[0060] The present invention uses the CRISPR / Cas9 system to knock out the hestia gene, and screens out a 23bp sgRNA recognition target (TS) located in exon 1 after extensive selection and testing of the gene sequence. Schematic diagram of the structure of the silkworm hestia gene and its target (TS) sequence as shown in figure 1 shown.
[0061] The sequence of the sgRNA recognition target is as follows:
[0062] 5'-GGATAAGTAAATTGAGAAGGTGG-3' (SEQ ID NO: 1).
[0063] sgRNA framework sequence (SEQ ID NO:11):
[0064] GNNNNNNNNNNNNNNNNNNNNN GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT
[0065] Wherein, the underlined part is the sgRNA targeting sequence.
[0066] According to the screened target (TS), the following primers sgF and sgR were synthesized:
[0067] sgF:
[0068] TAATACGACTCACTATAGGATAAGTAAATTGAGAAGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG ...
Embodiment 3
[0073] Embodiment 3, the acquisition of Cas9 mRNA
[0074] The template plasmid used to synthesize Cas9 mRNA is pTD1-Cas9 (Yueqiang Wang, Zhiqian Li, JunXu, Baosheng Zeng, lin ling, Lang You, Yazhou Chen, Yongping Huang*, and Anjiang Tan* .The CRISPR / Cas System mediates efficient genome engineering in Bombyxmori. Cell Research 23(12):1414-6.2013). The nucleotide sequence of the plasmid is shown as SEQ ID NO: 8, the first ATG is a start codon, and the last TAG is a stop codon. A nuclear localization signal precedes the stop codon.
[0075] The pTD1 vector contains the T7 promoter, 5'-UTR and 3'-UTR sequences, and the ORF of the Cas9 gene is connected between the 5'-UTR and 3'-UTR sequences, so pTD1-Cas9 can be used as a template for in vitro transcription of Cas9 mRNA . The pTD1-Cas9 vector was linearized with Not I restriction endonuclease, and the gel was collected and purified as a template for Cas9 mRNA synthesis. Use mMESSAGEmMACHINE T7 kit to transcribe mRNA in vit...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



