Nano-antibody for specifically recognizing duck hepatitis A virus 1

A duck hepatitis A virus and nanobody technology, applied in the field of molecular biology, can solve the problems of high detection cost, limited sources of polyclonal antibodies, and complexity, and achieve the effect of good stability

Active Publication Date: 2018-12-18
SHANDONG AGRICULTURAL UNIVERSITY
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the detection techniques of DHAV-1 mainly include enzyme-linked immunosorbent assay (ELISA), serum neutralization test, SPA synergistic agglutination test, etc. Most of the antibodies used in the detection are monoclonal antibodies and polyclonal antibodies, but monoclonal antibodies The R&D and production process is cumbersome and complicated; the source of polyclonal antibodies is limited, which makes the detection cost relatively high, and is not suitable for large-scale primary screening and bedside rapid detection in primary hospitals
However, there is no report on nanobodies that specifically recognize type 1 duck hepatitis A virus.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nano-antibody for specifically recognizing duck hepatitis A virus 1
  • Nano-antibody for specifically recognizing duck hepatitis A virus 1
  • Nano-antibody for specifically recognizing duck hepatitis A virus 1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Embodiment 1: the construction of anti-DHAV-1 single domain heavy chain antibody (that is, the single domain heavy chain antibody against DHAV-1) immune library

[0053] Take 3ml of DHAV-1 inactivated vaccine to immunize Bactrian camels by subcutaneous multi-point injection. Booster immunization with 3ml of DHAV-1 inactivated vaccine was carried out at intervals of 2 weeks. Blood was collected 7 days after each immunization, and serum titer was determined by indirect ELISA method. The sample with the highest serum titer was selected to separate lymphocytes and extract RNA.

[0054] The extraction of RNA was carried out according to the instruction manual of RNAiso reagent from TAKARA company. Using RNA as a template and oligo dT as a primer, the first strand of cDNA was synthesized according to the instructions of TAKARA reverse transcriptase.

[0055] The gene encoding the variable region of the heavy chain antibody was obtained by nested PCR using PrimeSTAR high-fide...

Embodiment 2

[0063] Example 2: Panning and Identification of Anti-DHAV-1 Single Domain Heavy Chain Antibody

[0064] The single-domain heavy-chain antibody against DHAV-1 was panned from the anti-DHAV-1 single-domain heavy-chain antibody immune library obtained in Example 1 by solid-phase affinity panning. Add 100 μL of DHAV-1 VP1 protein diluted with PBS to each enzyme-labeled well, and coat overnight at 4°C. The coating concentrations of each round of panning are 100, 80, and 40 μg / mL; aspirate the coating solution, PBS Wash the plate 5 times, add 200 μL 5% skimmed milk powder to each well, block for 2 hours at 37°C; wash the plate 5 times with PBS, add 100 μL phage antibody library (about 5×10 10 CFU), 37°C, incubate for 2h; aspirate unbound phage, wash the plate with PBST (containing 0.5% Tween-20) for 3-5 times (increase 5 times for each round), and then wash the plate with PBS for 15-25 times; 100 μL of eluent (glycine-hydrochloric acid, pH 2.2) was used to elute the phage adsorbed ...

Embodiment 3

[0069] Example 3: Scale preparation of anti-DHAV-1 single domain heavy chain antibody

[0070] Acquisition of the DNA fragment encoding the anti-DHAV-1 single domain heavy chain antibody: the variable region encoding gene of the heavy chain antibody was obtained by PCR using the EX Taq DNA polymerase of TAKARA company (see Table 3 for the primers used), agarose gel The anti-DHAV-1 single domain heavy chain antibody gene was recovered by electrophoresis.

[0071] Table 3: Primers for Amplifying Heavy Chain Antibody Variable Regions

[0072] Primer name

Primer sequence (5'-3')

serial number

VHH-F

GGG GGATCC CAGGTCCAACTGCAGGAGTCT

SEQ ID NO.8

VHH-R

GCC AAGCTT TGAGGAGACGGTGACCTGGG

SEQ ID NO.9

[0073] Note: The underlined sequences are restriction enzyme sites.

[0074] The obtained anti-DHAV-1 single-domain heavy-chain antibody gene fragment was cloned into the expression vector pET28as (6XHis tag and SUMO tag were fused a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nano-antibody for specifically recognizing duck hepatitis A virus 1. The amino acid sequence of the nano-antibody is represented by SEQ ID NO.1. The nano-antibody has the advantages of small molecular weight, high stability, excellent antigen binding performance and easy expression, and provides a basis for the detection of the duck hepatitis A virus 1 and the developmentof treatment medicines. A mutant with good endophilicity, specificity and stability can be obtained through reconstructing by using a random or site-directed mutagenesis technology with the nano-antibody as a precursor, and is used for developing proteins or polypeptides for being further used in medicines, industries and agriculture.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a nanobody specifically recognizing type 1 duck hepatitis A virus. Background technique [0002] Duck hepatitis A virus type 1 (DHAV-1) is a single-stranded positive-sense RNA virus mainly infecting ducklings under 3 weeks old, belonging to the family Picornaviridae. The virus is about 7.8kb in length, including a 5' non-translated region (UTR), a large open-reading frame (ORF), a 3' UTR (3' untranslated regions) and a poly(A) tail. The viral RNA directs the synthesis of a complete protein, called polyprotein. Polyproteins are continuously hydrolyzed by their own encoded proteases during translation and decomposed into small fragment proteins, which are structural proteins (VP1, VP0, VP3) and non-structural proteins (2A1, 2A2, 2A3, 2B, 2C, 3A, 3B , 3C, 3D). Among them, the VP1 gene has a full length of 714bp and encodes a polypeptide of 238 aa. In picornaviruses, VP...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K16/10C12N15/85C12N15/13G01N33/569A61K39/42A61P31/14A61P1/16
CPCA61K2039/505A61P1/16A61P31/14C07K16/1009C07K2317/565C07K2317/569C12N15/85G01N33/56983G01N2333/085
Inventor姜世金薛文湘张瑞华
OwnerSHANDONG AGRICULTURAL UNIVERSITY