Erythroculter ilishaeformis deoxyribonucleic acid (DNA) bar code sequence and application thereof
A technology of red tuna and bar code, which is applied in the field of species identification, can solve the problems of incomplete sample preservation, small amount of samples, difficulty in classification and identification research, etc., and achieve the effect of convenient and quick identification.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0014] Utilize embodiment below to further illustrate the present invention:
[0015] 5 samples of red salamander from the Xiangjiaba reservoir area of the Jinsha River system were taken for verification.
[0016] 1. Extraction of DNA
[0017] Cut about 5mg of fish muscle tissue, shred it as much as possible, put it in a 1.5ml centrifuge tube, and place it at room temperature. After the ethanol is completely evaporated, use the cell / tissue genome kit of GENEray company to extract genomic DNA. .
[0018] 2. PCR amplification
[0019] The general primers of COI gene in carps were used as PCR primers. The sequences of the upstream and downstream primers were: FCOI: TCAACCAACCACAAAGACATTGGCAC, RCOI: TAGACTTCTGGGTGGCCAAAGAATCA. The total volume of the PCR reaction system was 50 μl, and a PCR kit was used for PCR amplification. The specific components are shown in Table 1, and the PCR reaction procedure is shown in Table 2.
[0020] Table 1 PCR reaction system
[0021] ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com


