Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Erythroculter ilishaeformis deoxyribonucleic acid (DNA) bar code sequence and application thereof

A technology of red tuna and bar code, which is applied in the field of species identification, can solve the problems of incomplete sample preservation, small amount of samples, difficulty in classification and identification research, etc., and achieve the effect of convenient and quick identification.

Inactive Publication Date: 2018-12-21
JIANGHAN UNIVERSITY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In actual operation, problems such as small amount of specimens and incomplete preservation of samples are often encountered, which brings great difficulties to traditional species classification and identification research.
In the existing technology centers, there is no record and report of the DNA barcode sequence of the red catfish and the COI gene of the red catfish as the standard detection sequence of the red catfish DNA barcode

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Erythroculter ilishaeformis deoxyribonucleic acid (DNA) bar code sequence and application thereof
  • Erythroculter ilishaeformis deoxyribonucleic acid (DNA) bar code sequence and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0014] Utilize embodiment below to further illustrate the present invention:

[0015] 5 samples of red salamander from the Xiangjiaba reservoir area of ​​the Jinsha River system were taken for verification.

[0016] 1. Extraction of DNA

[0017] Cut about 5mg of fish muscle tissue, shred it as much as possible, put it in a 1.5ml centrifuge tube, and place it at room temperature. After the ethanol is completely evaporated, use the cell / tissue genome kit of GENEray company to extract genomic DNA. .

[0018] 2. PCR amplification

[0019] The general primers of COI gene in carps were used as PCR primers. The sequences of the upstream and downstream primers were: FCOI: TCAACCAACCACAAAGACATTGGCAC, RCOI: TAGACTTCTGGGTGGCCAAAGAATCA. The total volume of the PCR reaction system was 50 μl, and a PCR kit was used for PCR amplification. The specific components are shown in Table 1, and the PCR reaction procedure is shown in Table 2.

[0020] Table 1 PCR reaction system

[0021] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an erythroculter ilishaeformis deoxyribonucleic acid (DNA) bar code sequence and application thereof, and belongs to the technical field of species identification. The erythroculter ilishaeformis DNA bar code sequence is as shown in SEQ ID NO:1, and is an erythroculter ilishaeformis COI (cytochrome c oxidase subunit I) gene. The DNA bar code sequence can be used as a standard test sequence for erythroculter ilishaeformis DNA and can be used for effectively identifying erythroculter ilishaeformis species.

Description

technical field [0001] The invention belongs to the technical field of species identification, and in particular relates to a DNA barcode sequence and application of the red catfish. Background technique [0002] Erythroculter ilishaeformis, belonging to Cyprinidae subfamily Culterinae, Erythroculter, is mainly distributed in the Yangtze River system. Red carp is a eurythermic fish with strong adaptability and disease resistance, rapid growth and large body size. It is a large-scale freshwater economic fish in the middle and upper layers. Due to the similar morphological characteristics of the fishes of the subfamily of Cichlidae, different species of fish are often confused and difficult to distinguish. Therefore, it is necessary to effectively identify the species. [0003] DNA barcode refers to a relatively short DNA fragment that can represent the species in an organism, has sufficient variation, is standard, is easy to amplify, and can be quickly and accurately identif...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12Q1/6888
CPCC12N9/0053C12Q1/6888C12Q2600/166C12Y109/03001
Inventor 刘红艳熊飞
Owner JIANGHAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products