Avian leukemia double plate agglutination antigen of chicken pullorum disease-J subgroup and preparation method thereof
A technology for avian leukemia and pullorum is applied to the field of Salmonella pullorum and its construction, which can solve the problems of small particles and inability to achieve agglutination, and achieve the effects of saving detection costs and time.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] The construction of the surface display plasmid pQE80-lpp-ompA-gp85, the construction strategy is as follows figure 1 As shown, the steps are:
[0028] 1. Cloning of lpp and construction of pQE80-lpp plasmid
[0029] According to the published E.coli lpp sequence in GeneBank (accession number: NC_000913.3), design primers:
[0030] lppF:CAT GGATCC ATGAAAGCTACTAAACTGGTACT (the underline is the restriction site of BamH 1)
[0031] lppR:CAT GAGCTC GTCAGAAGACAGCTGATCGA (Sac 1 restriction site is underlined)
[0032]The target fragment lpp was subjected to PCR amplification, and the PCR product was subjected to 1% agarose gel electrophoresis, and the target fragment lpp (99bp) was recovered with a DNA recovery kit, and its nucleotide sequence was shown in SEQ ID NO.1. The recovered target fragment lpp and plasmid pQE80 were double-digested with restriction endonucleases BamH Ⅰ and Sac Ⅰ, respectively, and the digested products were subjected to 1% agarose gel electrop...
Embodiment 2
[0045] Preparation of Agglutinating Antigen on Double Plate of Pullorum-J Subgroup Avian Leukemia
[0046] 1. Construction of Salmonella pullorum SP TC07 / pQE80-lpp-ompA-gp85 displaying GP85 on the surface
[0047] The frozen Salmonella pullorum SP TC07 (separated from the liver of chicks from an affected chicken farm in Wuhan, Hubei Province and stored in our laboratory) was inoculated in LB solid medium and cultured overnight in an incubator at 37°C. On the next day, pick a single colony on the culture medium and inoculate it in 5ml LB liquid medium, and shake overnight at 220r / min in a shaker at 37°C. Add bacterial solution to 50ml LB liquid medium at a ratio of 1:100, shake in a shaker at 37°C at 220r / min until the OD value is about 0.6, and cool on ice for at least 15min. The cooled cells were centrifuged at 5000 g for 15 min at 4°C, the supernatant was discarded, the cells were resuspended with 40 ml of sterilized 10% pre-cooled glycerol, and the washing was repeated thr...
Embodiment 3
[0054] Application of double-plate agglutination antigen in pullorum-J subgroup avian leukemia
[0055] 1. Application of double-plate agglutination antigen of pullorum-J subgroup avian leukemia
[0056] (1) Reaction with standard serum and result judgment
[0057] If agglutination occurs, it is judged as positive for pullorum or J subgroup avian leukemia, and if agglutination does not occur, it is negative. Such as Figure 5 As shown, A means that it reacts with negative serum without agglutination, and it is judged as negative; B means it reacts with pullorum positive serum and agglutination occurs, and it is judged as positive; C means it reacts with J subgroup avian leukemia positive serum and agglutination occurs, judged to be positive.
[0058] (2) Specificity test
[0059] The double-plate agglutinated antigen of pullorum-J subgroup avian leukemia was mixed with 9 positive sera (Salmonella pullorum positive serum, Salmonella enteritidis positive serum, poultry colib...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



