Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Avian leukemia double plate agglutination antigen of chicken pullorum disease-J subgroup and preparation method thereof

A technology for avian leukemia and pullorum is applied to the field of Salmonella pullorum and its construction, which can solve the problems of small particles and inability to achieve agglutination, and achieve the effects of saving detection costs and time.

Inactive Publication Date: 2019-01-15
INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although the GP85 protein alone can react with the J subgroup avian leukosis antibody, it cannot achieve visible agglutination due to the small particle size

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Avian leukemia double plate agglutination antigen of chicken pullorum disease-J subgroup and preparation method thereof
  • Avian leukemia double plate agglutination antigen of chicken pullorum disease-J subgroup and preparation method thereof
  • Avian leukemia double plate agglutination antigen of chicken pullorum disease-J subgroup and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] The construction of the surface display plasmid pQE80-lpp-ompA-gp85, the construction strategy is as follows figure 1 As shown, the steps are:

[0028] 1. Cloning of lpp and construction of pQE80-lpp plasmid

[0029] According to the published E.coli lpp sequence in GeneBank (accession number: NC_000913.3), design primers:

[0030] lppF:CAT GGATCC ATGAAAGCTACTAAACTGGTACT (the underline is the restriction site of BamH 1)

[0031] lppR:CAT GAGCTC GTCAGAAGACAGCTGATCGA (Sac 1 restriction site is underlined)

[0032]The target fragment lpp was subjected to PCR amplification, and the PCR product was subjected to 1% agarose gel electrophoresis, and the target fragment lpp (99bp) was recovered with a DNA recovery kit, and its nucleotide sequence was shown in SEQ ID NO.1. The recovered target fragment lpp and plasmid pQE80 were double-digested with restriction endonucleases BamH Ⅰ and Sac Ⅰ, respectively, and the digested products were subjected to 1% agarose gel electrop...

Embodiment 2

[0045] Preparation of Agglutinating Antigen on Double Plate of Pullorum-J Subgroup Avian Leukemia

[0046] 1. Construction of Salmonella pullorum SP TC07 / pQE80-lpp-ompA-gp85 displaying GP85 on the surface

[0047] The frozen Salmonella pullorum SP TC07 (separated from the liver of chicks from an affected chicken farm in Wuhan, Hubei Province and stored in our laboratory) was inoculated in LB solid medium and cultured overnight in an incubator at 37°C. On the next day, pick a single colony on the culture medium and inoculate it in 5ml LB liquid medium, and shake overnight at 220r / min in a shaker at 37°C. Add bacterial solution to 50ml LB liquid medium at a ratio of 1:100, shake in a shaker at 37°C at 220r / min until the OD value is about 0.6, and cool on ice for at least 15min. The cooled cells were centrifuged at 5000 g for 15 min at 4°C, the supernatant was discarded, the cells were resuspended with 40 ml of sterilized 10% pre-cooled glycerol, and the washing was repeated thr...

Embodiment 3

[0054] Application of double-plate agglutination antigen in pullorum-J subgroup avian leukemia

[0055] 1. Application of double-plate agglutination antigen of pullorum-J subgroup avian leukemia

[0056] (1) Reaction with standard serum and result judgment

[0057] If agglutination occurs, it is judged as positive for pullorum or J subgroup avian leukemia, and if agglutination does not occur, it is negative. Such as Figure 5 As shown, A means that it reacts with negative serum without agglutination, and it is judged as negative; B means it reacts with pullorum positive serum and agglutination occurs, and it is judged as positive; C means it reacts with J subgroup avian leukemia positive serum and agglutination occurs, judged to be positive.

[0058] (2) Specificity test

[0059] The double-plate agglutinated antigen of pullorum-J subgroup avian leukemia was mixed with 9 positive sera (Salmonella pullorum positive serum, Salmonella enteritidis positive serum, poultry colib...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a avian leukemia double plate agglutination antigen of chicken pullorum disease-J subgroup and a preparation method thereof. The method includes constructing a plasmid vector displaying avian leukemia specific antigen GP85 of subgroup J on the surface, and transferring it into the strain for preparing chicken pullorum antigen to construct Salmonella pullorum which can display GP85 on the surface. The Salmonella pullorum can simultaneously express the surface antigen of Salmonella pullorum and the specific antigen of avian leukosis virus subgroup J through IPTG, and canbe used for preparing the double plate agglutination antigen. The double plate agglutination antigen can be used to detect two kinds of epidemic antibodies at the same time by one reaction. The operation is simple, the specificity is strong, the detection time and the detection cost are obviously saved, and the double antigen can be used for rapid detection of fence edge.

Description

technical field [0001] The invention belongs to the technical field of bioengineering and detection, and in particular relates to a Salmonella pullorum with the specific antigen GP85 displayed on the surface of the pullorum pullorum and a construction method thereof. The transformed Salmonella pullorum pullorum can prepare double plate agglutination of pullorum-J subgroup avian leukemia Antigen for simultaneous detection of antibodies against Salmonella pullorum and avian leukosis virus infection. Background technique [0002] Pullorum pullorum and avian leukemia are two infectious diseases that seriously endanger the poultry industry in my country. Among them, pullorum (Pullorum Disease, PD) is a kind of infectious disease caused by Salmonella pullorum (SP). Salmonella pullorum can be transmitted vertically and horizontally, which is very harmful to chicks. Infected chicks show that they do not eat feed and are afraid of cold. The body is curled up, breathing is difficult,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/74C12P21/02G01N33/569C12R1/42
CPCC07K14/005C12N15/74C12N2740/11022C12P21/02G01N33/56916G01N33/56983
Inventor 张腾飞王红琳汪宏才罗青平邵华斌张文婷温国元张蓉蓉罗玲卢琴商雨郭晓东程伊洛
Owner INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com