Halohydrin dehalogenase mutant and applications thereof

A technology of halohydrin dehalogenase and mutants, which is applied in the field of molecular biology and biology, and can solve the problems of low enzyme activity, few types of halohydrin dehalogenase, and low product yield

Inactive Publication Date: 2019-02-01
ZHEJIANG UNIV
View PDF9 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] (3R,5R)-6-cyano-3,5-dihydroxyhexanoic acid tert-butyl ester can be dehalogenated by (3R,5S)-6-chloro-3,5-dihydroxyhexanoic acid tert-butyl ester Preparation, the alkaline environment in the traditional chemical synthesis process will cause the spontaneous hydrolysis of the substrate, resulting in low product yield, and the use of halohydrin dehalogenase to catalyze the reaction has mild reaction conditions and few side reactions, which has great application potential
[0006] The main problem in the existing research is that there are few types of halohydrin dehalogenases, and the enzyme activity against the substrate (3R,5S)-6-chloro-3,5-dihydroxyhexanoic acid tert-butyl ester is very low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Halohydrin dehalogenase mutant and applications thereof
  • Halohydrin dehalogenase mutant and applications thereof
  • Halohydrin dehalogenase mutant and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] 1. Construction of wild-type halohydrin dehalogenase recombinant bacteria

[0050] Primers were designed according to the gene sequence of halohydrin dehalogenase, with the upstream primer F_HheA AM -CGC GGATCC ATGCGTATCGCTCTGGTGACG (underlined base is the recognition site of restriction endonuclease BamH I) and downstream primer R_HheA AM -CCC AAGCTT TTACGGCAGATAGCCGCCAG (underlined base is the recognition site of restriction endonuclease Hind III) to plasmid pUC57-HheA AM (synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., optimized for expression codons in E.coli) for PCR amplification to obtain the target gene.

[0051] Wherein, the reaction system of PCR is:

[0052]

[0053] The PCR program is: 98°C for 2min; 98°C for 10s, 58°C for 15s, 72°C for 10s (generally 5s / kb), 30 cycles; 72°C for 5min; 4°C for heat preservation.

[0054] After the size of the PCR product was verified by 1% agarose gel electrophoresis, it was purified and recovered with a ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a halohydrin dehalogenase mutant and applications thereof, wherein the mutant is subjected to one or a plurality of the following mutations that the arginine at the site 84 isreplaced by alanine, serine, histidine or asparagine, the arginine at the site 88 is replaced by leucine, valine, threonine, cysteine, phenylalanine or isoleucine, the valine at the site 136 is replaced by threonine or serine, and the asparagine at the site 144 is replaced by cysteine, histidine or threonine. According to the present invention, the halohydrin dehalogenase HheAAM is modified by respectively using the directed evolution and the semi-rational design, wherein the results show that the sites 84, 88, 136 and 144 can affect the enzyme activity; and the four key sites are subjected tocombined mutation by using the iterative saturation mutation strategy, and are subjected to random combined mutation by using the combined active site saturation experiment strategy, such that the specific enzyme activity of the screened mutant is 801.59 U.g<-1>, and is 12 times the specific enzyme activity of the original enzyme.

Description

technical field [0001] The invention relates to the fields of molecular biology and biotechnology, in particular to a halohydrin dehalogenase mutant and application thereof. Background technique [0002] In 2017, The Lancet published the three causes of death that caused the largest number of deaths in 2016. Cardiovascular and cerebrovascular diseases have become the leading cause of human death. [0003] In the past, statins were mostly used to regulate blood lipids, and later found that they also have anti-inflammatory effects, improve arterial endothelial function, inhibit myocardial remodeling, and stabilize atherosclerotic plaques. They can be used to treat and prevent cardiovascular and cerebrovascular diseases. Among them, atorvastatin calcium is a relatively classic and effective statin drug, and (3R,5R)-6-cyano-3,5-dihydroxyhexanoic acid tert-butyl ester is the synthesis process of atorvastatin calcium The key chiral building blocks in . [0004] Halohydrin dehalo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/88C12N15/60C12N15/70C12N1/21C12P13/00C12R1/19
CPCC12N9/88C12N15/70C12P13/002C12Y405/01
Inventor吴坚平王露徐刚杨立荣
OwnerZHEJIANG UNIV