Paired sgRNA for gene editing and application thereof

A gene editing and gene technology, applied in the field of gene editing, can solve problems such as obstacles, and achieve the effect of technical flexibility, high efficiency, and good homogeneity

Pending Publication Date: 2019-02-01
ZHEJIANG UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Obviously, this inherent precision NHEJ repair is not conducive to mutation generation, hindering CRISPR / Cas9-mediated mutation-based gene editing (including gene knockout)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Paired sgRNA for gene editing and application thereof
  • Paired sgRNA for gene editing and application thereof
  • Paired sgRNA for gene editing and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Improved paired Cas9-sgRNA gene editing method

[0049] 1. The establishment of a theoretical system based on the precise NHEJ-based paired Cas9-sgRNA gene editing method

[0050] In recent years, gene editing technology using a single sgRNA to guide Cas9 has been widely used, especially gene knockout based on frameshift mutations. This technology uses non-precise NHEJ repair to generate additions and deletions, of which only some additions and deletions (theoretically two-thirds) will result in a frameshift mutation of a single allele and knock out one of the alleles, but the addition and deletion base sequences are mixed and long and short. Different, NHEJ products are highly heterogeneous, and the efficiency of simultaneous biallelic knockout is low. At the same time, this application also ignores an important problem, that is, because the ends of the DSB generated by Cas9 cleavage can be directly connected, NHEJ repair may be mainly accurate, and the efficienc...

Embodiment 2

[0226] Example 2: Knock out the MDC1 gene

[0227] In order to use paired Cas9-sgRNA technology to knock out mouse MDC1 (gene ID: 240087) gene, we designed three pairs of sgRNA (mMDC1-1: ACAGATCATGGAAAGCACCC; mMDC1-2: AGCATCCCAGTCAATCACCT; mMDC1) on exon 2 of MDC1 gene. -3: AACTATCCAGTGGCTCCTT), a single sgRNA and a paired sgRNA were respectively transfected into mouse embryonic stem cells. After 3 days, PCR amplification and DNA electrophoresis analysis found that the paired sgRNA2 / sgRNA3 (C / W, 52bp) had high editing efficiency ( Figure 15 In a), deep sequencing also shows that the efficiency of precise ligation is about 50%, and the frequency of templated insertion is about 5% ( Figure 15 In b). Therefore, we chose this pair of sgRNA to guide Cas9 to knock out the MDC1 gene, and select a monoclonal cell line from the cells edited by the paired Cas9-sgRNA. Specifically, the selected paired Cas9-sgRNA expression plasmid is transfected into mouse embryonic stem cells, the transf...

Embodiment 3

[0232] Example 3: Deleting gene fragments encoding 53BP1 domain with precise whole code

[0233] The paired sgRNA technology can control the length of excision fragments and can be used for precise whole-code excision, which can realize the functional study of specific gene fragments without generating frameshift mutations, especially for the study of some lethal gene domain fragments. In order to verify this application, we selected the 53BP1 gene (Gene ID: 27223) as the research object, targeting the key domains of 53BP1, Tudor and OD, which are necessary for the recruitment of 53BP1 protein to the DSB injury site ( Figure 16 In a). We designed paired sgRNAs for these two domains (Tudor domains: GGGAAGATCACCCGAGATGT and GGGTACGAATGTGACGTGCT; OD domains: GAGTGTACGGACTTCTCGAA and TTATGTGGATGGGACAGAAG). The length of the excised DNA fragments between these two paired sgRNAs is 3n bases. In this way, in gene editing, the two broken ends can be connected by precise NHEJ to achieve ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a paired sgRNA for gene editing and an application thereof. A plurality of sgRNAs are designed according to the specific editing requirements of a target gene or a target genomic site, and two sgRNAs with specific spacing and corresponding PAM specific position combinations are selected as paired sgRNAs. The paired Cas9-sgRNA of the invention can improve gene editing efficiency and precision, and can be used for quantitative analysis of NHEJ in cells and animals, which includes total NHEJ efficiency (ie, total editing efficiency), frequency and proportion of precise NHEJ and mutant NHEJ, addition and deletion direction, length and frequency of a mutant NHEJ interface, and the availability of micro-homologous sequences of the mutant NHEJ interface. The technology ismore flexible, simple, and fast, the paired sgRNA can be easily transplanted into various cells and tissues, and the accuracy is not affected.

Description

(1) Technical field [0001] The present invention relates to a gene editing method, in particular to a set of highly efficient precision non-homologous end joining (NHEJ) repair pathways to improve the efficiency of CRISPR / Cas9 gene editing based on precise deletion of specific length DNA fragments And precision methods. (2) Background technology [0002] Clustered, regularly spaced short Palindromic Repeats CRISPR (Clustered Regularly Interspersed Short Palindromic Repeats) is currently the most widely used genome editing system. It is an immune mechanism modification that degrades invading virus DNA or other foreign DNA from bacteria and archaea. Come. The most commonly used system is the CRISPR / Cas9 system, which contains three elements: Cas9 protein, crRNA (CRISPR-associated RNA) and tracrRNA (trans-activating crRNA). The Cas9 protein first binds to crRNA and tracrRNA to form a complex, and then unwinds by recognizing and binding the PAM (protospacer adjacent motif) motif of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/63C12N15/90
CPCC12N15/113C12N15/63C12N15/902C12N2310/10C12N2310/20
Inventor谢安勇冯依力郭涛
OwnerZHEJIANG UNIV