Rice transcription factor os07g05010 gene and its application
A technology of rice and DNA molecules, which is applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems such as difficulty in seedling emergence affecting the amount of direct seeding rice, increase of production cost, difficulty in emergence of seedlings, etc., and achieve the effect of improving light energy utilization ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0066] Embodiment 1, the acquisition of Os07g05010 gene
[0067]1. Obtaining plant cDNA
[0068] RNA was extracted from rice leaves of Zhonghua 11, and cDNA was obtained by reverse transcription.
[0069] 2. PCR amplification
[0070] Using the cDNA obtained in step 1 as a template, PCR amplification was performed using F and R primers to obtain a PCR amplification product of 1254bp.
[0071] The primer sequences are as follows:
[0072] Forward primer F: 5'-GGATCCGAATTCTCTAGA ATGGATGCGGGTGCAAC -3';
[0073] Reverse primer R: 5'-AAGCTTCTCGAG TTTTATGGTCCCATCAGATGAGGATG -3'.
[0074] 3. Acquisition of Os07g05010 gene
[0075] The PCR amplification products were detected by 1% agarose gel electrophoresis, recovered and purified for sequencing.
[0076] The sequencing results showed that a product with a size of 1257bp was obtained by PCR amplification, and it was named Os07g05010 gene. Its nucleotide sequence is shown in sequence 1 in the sequence table, and the open re...
Embodiment 2
[0077] Example 2. Acquisition and stress tolerance analysis of rice overexpressing the Os07g05010 gene
[0078] 1. Obtaining rice overexpressing the Os07g05010 gene
[0079] 1. Preparation of recombinant vector for overexpression of Os07g05010 gene
[0080] Using Zhonghua 11 rice seedling cDNA as a template, using forward primer F and reverse primer R, PCR amplification was carried out to obtain a 1254bp PCR amplification product (Os07g05010 open reading frame ORF, the nucleotide sequence of which is sequence 1 first- 1254 bits).
[0081] The above PCR amplification product was ligated to the pEASY-Blunt-Simple cloning vector to obtain pEASY-Os07g05010.
[0082] pEASY-Os07g05010 was digested with EcoRI / XhoI to obtain the full-length 1254bp Os07g05010 ORF, which was connected to the EcoRI / SalI digested p1302-UBQp-HYN-GFP vector (Wuhan Tianwen Biotechnology Co., Ltd.) to obtain Os07g05010-GFP.
[0083] After sequencing, the recombinant vector Os07g05010-GFP overexpressing the...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com