Rice transcription factor os07g05010 gene and its application

A technology of rice and DNA molecules, which is applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems such as difficulty in seedling emergence affecting the amount of direct seeding rice, increase of production cost, difficulty in emergence of seedlings, etc., and achieve the effect of improving light energy utilization ability

Active Publication Date: 2020-11-03
INST OF BOTANY CHINESE ACAD OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the shortage of labor force, direct seeding of rice is widely used in production as a simple and efficient cultivation method, but the difficulty of seedling emergence is the shortcoming of this sowing method
Difficulty in seedling emergence directly affects the amount of seed used for direct-seeding rice and increases production costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice transcription factor os07g05010 gene and its application
  • Rice transcription factor os07g05010 gene and its application
  • Rice transcription factor os07g05010 gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Embodiment 1, the acquisition of Os07g05010 gene

[0067]1. Obtaining plant cDNA

[0068] RNA was extracted from rice leaves of Zhonghua 11, and cDNA was obtained by reverse transcription.

[0069] 2. PCR amplification

[0070] Using the cDNA obtained in step 1 as a template, PCR amplification was performed using F and R primers to obtain a PCR amplification product of 1254bp.

[0071] The primer sequences are as follows:

[0072] Forward primer F: 5'-GGATCCGAATTCTCTAGA ATGGATGCGGGTGCAAC -3';

[0073] Reverse primer R: 5'-AAGCTTCTCGAG TTTTATGGTCCCATCAGATGAGGATG -3'.

[0074] 3. Acquisition of Os07g05010 gene

[0075] The PCR amplification products were detected by 1% agarose gel electrophoresis, recovered and purified for sequencing.

[0076] The sequencing results showed that a product with a size of 1257bp was obtained by PCR amplification, and it was named Os07g05010 gene. Its nucleotide sequence is shown in sequence 1 in the sequence table, and the open re...

Embodiment 2

[0077] Example 2. Acquisition and stress tolerance analysis of rice overexpressing the Os07g05010 gene

[0078] 1. Obtaining rice overexpressing the Os07g05010 gene

[0079] 1. Preparation of recombinant vector for overexpression of Os07g05010 gene

[0080] Using Zhonghua 11 rice seedling cDNA as a template, using forward primer F and reverse primer R, PCR amplification was carried out to obtain a 1254bp PCR amplification product (Os07g05010 open reading frame ORF, the nucleotide sequence of which is sequence 1 first- 1254 bits).

[0081] The above PCR amplification product was ligated to the pEASY-Blunt-Simple cloning vector to obtain pEASY-Os07g05010.

[0082] pEASY-Os07g05010 was digested with EcoRI / XhoI to obtain the full-length 1254bp Os07g05010 ORF, which was connected to the EcoRI / SalI digested p1302-UBQp-HYN-GFP vector (Wuhan Tianwen Biotechnology Co., Ltd.) to obtain Os07g05010-GFP.

[0083] After sequencing, the recombinant vector Os07g05010-GFP overexpressing the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses rice transcription factor Os07g05010 gene and application thereof, namely application of any of substances 1) to 3) in items a to e. The substances include: protein OS07G05010protein 1); DNA molecule 2) to encode the protein OS07G05010; a recombinant vector, expression cassette, transgenic cell line or recombinant bacterium 3) containing the DNA molecule to encode the protein OS07G05010. The items include: a) regulation of elongation of plumular axis in rice; b) regulation of plant salt resistance; c) regulation of rice seedling emergence; d) regulation of net photosynthetic rate of rice; e) screening or cultivation or development of direct seeding varieties suitable for saline-alkaline soil. Tests prove that a plant with Os07g05010 gene overexpression shows elongation of mesocotyl and enhanced resistance to salt stress; it is indicated that the Os07g05010 gene can function to regulate elongation of plant plumular axis and resist salt.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a rice transcription factor Os07g05010 gene and application thereof. Background technique [0002] Rice is the main food crop in my country. Due to the shortage of labor, direct seeding of rice is widely used as a simple and efficient cultivation method in production, but the difficulty of seedling emergence is the shortcoming of this sowing method. Difficulty in seedling emergence directly affects the amount of seed used for direct-seeding rice and increases production costs. During rice seedling emergence, mesocotyl elongation is needed to provide power for emergence, and it also needs to respond to the soil environment. The main rice production areas in my country are mainly concentrated in the Northeast and the middle and lower reaches of the Yangtze River, and most of the rice planting areas in the Northeast belong to saline-alkali land, which is a stressful enviro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8261C12N15/8273
Inventor 林荣呈莫伟平唐为江
Owner INST OF BOTANY CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap