Oyster CRISPR/Cas9 gene editing method

A gene editing, oyster technology, applied in genetic engineering, biochemical equipment and methods, other methods of inserting foreign genetic material, etc.

Active Publication Date: 2019-02-26
OCEAN UNIV OF CHINA
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These undoubtedly bring great challenges to the microinjection gene editing of oysters

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oyster CRISPR/Cas9 gene editing method
  • Oyster CRISPR/Cas9 gene editing method
  • Oyster CRISPR/Cas9 gene editing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0022] Taking the long oyster SET and MYND domain containing 5 (SMYD5) gene as an example, the oyster gene editing technology was established, which will be further elaborated below.

[0023] 1) Obtaining fertilized eggs of long oyster

[0024] The oyster broodstock with mature gonads was selected, and the fertilized eggs were collected by dissection, artificially inseminated, and the fertilized eggs obtained were used for gene editing.

[0025] 2) Construction of the sgRNA of the long oyster target gene SMYD5

[0026] For the second exon of the long oyster target gene SMYD5 (GeneID: 105330417), the sgRNA target site was designed online, which is GGCTGCTGCTTACGAAGAGAGGG, where the PAM sequence is GGG; the specific steps are as follows: design a forward primer Sg-smyd1F , the primer sequence is 5'-GATCACTAATACGACTCACTATA GGCTGCTGCTTACGAAGAGAGTTTTAGAGCTAGAAAT-3' (including the T7 promoter sequence), using the DR274 plasmid (Addgene plasmid 42250) as a template, using the forwar...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
angleaaaaaaaaaa
Login to View More

Abstract

The invention discloses an oyster CRISPR / Cas9 gene editing method. The method comprises the following steps: screening a sgRNA target site sequence of a gene to be edited, designing a sgRNA sequence of a target sequence, and performing in vitro transcription to obtain a high-concentration target gene sgRNA; mixing sgRNA with Cas9 protein in equal volume, then reacting at 37 DEG C for 15 minutes, mixing with a phenol red solution in equal volume, introducing the mixture into oyster fertilized eggs by a microinjection method, and detecting oyster embryos or larvae after incubation for 6 hours toobtain corresponding gene mutants. According to the invention, an oyster gene editing technology is successfully established for the first time, and the technology can be used for studying the function of oyster genes and accurately modifying endogenous genes of oysters to provide a technical support for genetic improvement breeding of oysters.

Description

technical field [0001] The invention relates to the technical field of gene function verification research in aquatic animals, and more specifically relates to an oyster CRISPR / Cas9 gene editing method. Background technique [0002] Oyster is a worldwide distribution group, and it is the economic shellfish with the highest output in my country and the world. In 2016, my country's oyster aquaculture output reached 4.835 million tons, accounting for 34% of my country's total shellfish aquaculture output, accounting for 81.5% of the world's total oyster production. In recent years, the genetic breeding of oysters in various countries has been carried out one after another, and new varieties of oysters have been bred successively in my country, such as "Haida No. 1" and "Haida No. 2". However, at present, the genetic breeding of oysters is still mainly based on the traditional artificial breeding methods, and technologies such as genome-wide selective breeding and molecular-ass...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/90C12N15/89C12N15/10
CPCC12N15/102C12N15/89C12N15/902
Inventor于红李琪李绘娟许瑞岳晨阳
OwnerOCEAN UNIV OF CHINA