Saccharomyces cerevisiae and its use

A technology of Saccharomyces cerevisiae and fruit wine, which is applied in the preparation of alcoholic beverages, fungi, microorganisms, etc., to achieve the effects of unique mellow taste, fragrant aroma and high health care ability

Active Publication Date: 2022-06-03
LUZHOU PINCHUANG TECH CO LTD +1
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved by the present invention is: the lack of a mulberry fruit wine Saccharomyces cerevisiae with good fermentation performance, unique flavor and many functional substances retained in the existing market

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Saccharomyces cerevisiae and its use
  • Saccharomyces cerevisiae and its use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

Take an appropriate amount of culture medium and centrifuge for 1 min (12000 r min

-1

, 4°C), discard the supernatant to obtain an appropriate amount of bacteria, and use yeast genome

DNA extraction kit (TIANamp Yeast DNA Kit, Tiangen Biochemical Technology) was used to extract genomic DNA. Universal with Yeast ITS

Primer pair Forward primer ITS1 (SEQ ID NO: 2; tccgtaggtgaacctgcgg), reverse primer ITS4 (SEQ ID NO: 3;

tcctccgcttattgatatgc) to amplify genomic DNA, the reaction conditions are as follows: 94 ℃ pre-denaturation for 5min, enter the following cycle:

Denaturation at 94°C for 45s, annealing at 55°C for 40s, extension at 72°C for 60s, 35 cycles; extension at 72°C for 10 min. 1.0% agar for PCR products

The products were detected by lipose gel electrophoresis and the products were sent to Sangon Bioengineering (Shanghai) Co., Ltd. for sequencing. sequenced by BLAST

Column alignment, identified as Saccharomyces cerevisiae, named JNB-9.

The nucleotide sequen...

Embodiment 2

[0041]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
tolerance concentrationaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of Saccharomyces cerevisiae extraction, and in particular relates to Saccharomyces cerevisiae for mulberry fruit wine and its application in preparing mulberry fruit wine. Aiming at the lack of a mulberry fruit wine Saccharomyces cerevisiae with good fermentation performance, unique flavor and many functional substances retained in the existing market, the present invention provides a mulberry fruit wine Saccharomyces cerevisiae, which was preserved in China on September 10, 2018 General Microbiology Center of the Microbiological Culture Collection Management Committee, the deposit number is CGMCC No.16452. The Saccharomyces cerevisiae strain of the invention has good alcohol fermentation ability and good flavor, and can be used in the production of mulberry fruit wine and related alcoholic beverages.

Description

Mulberry wine Saccharomyces cerevisiae and its use technical field The invention belongs to the technical field of Saccharomyces cerevisiae extraction, be specifically related to a kind of mulberry wine Saccharomyces cerevisiae and its preparation Uses in mulberry wine. Background technique [0002] my country has abundant mulberry resources, but the development of deep processing of mulberries is relatively slow. At present, mulberries are mainly for consumption They are eaten fresh, and the time to market is relatively concentrated, resulting in a large number of mulberries rotting and deteriorating. By processing mulberries into mulberry wine, it can be reduced The waste of mulberry resources, while improving its economic value. However, the equipment and technology for deep processing of fruits are not complete, imperfect, and lacking. The lack of standardized relevant quality standards and management regulations, the lack of special yeast for specific varieties...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/18C12G3/024C12R1/865
CPCC12G3/02C12N1/18C12R2001/865C12N1/185Y02E50/10
Inventor李崎沈才洪钮成拓刘春凤王金晶李永仙郑飞云
OwnerLUZHOU PINCHUANG TECH CO LTD