Saccharomyces cerevisiae and its use
A technology of Saccharomyces cerevisiae and fruit wine, which is applied in the preparation of alcoholic beverages, fungi, microorganisms, etc., to achieve the effects of unique mellow taste, fragrant aroma and high health care ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
Take an appropriate amount of culture medium and centrifuge for 1 min (12000 r min
-1
, 4°C), discard the supernatant to obtain an appropriate amount of bacteria, and use yeast genome
DNA extraction kit (TIANamp Yeast DNA Kit, Tiangen Biochemical Technology) was used to extract genomic DNA. Universal with Yeast ITS
Primer pair Forward primer ITS1 (SEQ ID NO: 2; tccgtaggtgaacctgcgg), reverse primer ITS4 (SEQ ID NO: 3;
tcctccgcttattgatatgc) to amplify genomic DNA, the reaction conditions are as follows: 94 ℃ pre-denaturation for 5min, enter the following cycle:
Denaturation at 94°C for 45s, annealing at 55°C for 40s, extension at 72°C for 60s, 35 cycles; extension at 72°C for 10 min. 1.0% agar for PCR products
The products were detected by lipose gel electrophoresis and the products were sent to Sangon Bioengineering (Shanghai) Co., Ltd. for sequencing. sequenced by BLAST
Column alignment, identified as Saccharomyces cerevisiae, named JNB-9.
The nucleotide sequen...
Embodiment 2
[0041]
PUM
Property | Measurement | Unit |
---|---|---|
tolerance concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com