Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

CVA2 specific primer, real-time fluorescence detection kit and use of real-time fluorescence detection kit

A detection kit and real-time fluorescence technology, applied in the determination/inspection of microorganisms, microorganisms, recombinant DNA technology, etc., can solve problems such as increasing proportion, and achieve the effect of good specificity and good stability

Inactive Publication Date: 2019-03-19
东莞市第八人民医院
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in recent years, my country's epidemiological statistics show that the proportion of other enteroviruses, such as Coxsackievirus A2, has increased, and the composition of pathogenic spectrum is diversified and complicated.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CVA2 specific primer, real-time fluorescence detection kit and use of real-time fluorescence detection kit
  • CVA2 specific primer, real-time fluorescence detection kit and use of real-time fluorescence detection kit
  • CVA2 specific primer, real-time fluorescence detection kit and use of real-time fluorescence detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] A real-time fluorescence detection kit for detecting Coxsackievirus type A2, the kit is composed of RT-PCR reaction solution, CVA2 strong positive control substance, CVA2 weak positive control substance, and negative quality control standard substance, wherein the RT-PCR reaction Solution contains RT-PCR buffer, fluorescent dye (TB Green), magnesium ion and deoxyribonucleotide triphosphate mixture, Ex Taq HS DNA polymerase, PrimeScript reverse transcriptase, RNase inhibitor and CVA2 specific primer, negative The quality control standard is high temperature and high pressure sterilized diethyl pyrocarbonate treated water (DEPC water), and the CVA2 strong positive control and CVA2 weak positive control are positive plasmid samples containing the conserved sequence of the VP1 gene of CVA2.

[0030] The sequences of CVA2-specific primers are as follows:

[0031] Upstream primer CVA2-F: 5'-AAAATAGTGTGGAAGAGGCTAGTATAAAC-3',

[0032] Downstream primer CVA2-R: 5'-GCACTCGTACCTG...

Embodiment 2

[0037] 1. Method

[0038] 1.1 Primers and probes

[0039] Searched from the NCBI database in the United States, downloaded multiple sequences of Coxsackievirus type A2, used MEGA4.0 software for homology comparison analysis, and finally determined that the conserved VP1 gene of the virus was used as the detection region. Using Primer Premier 5.0 software to design highly specific upstream and downstream primers in its conserved region, and after BLAST alignment, it was confirmed that the primer pair had no non-specific binding to other species (viruses). The primer sequences are as follows:

[0040] Upstream primer CVA2-F: 5'-AAAATAGTGTGGAAGAGGCTAGTATAAAC-3',

[0041] Downstream primer CVA2-R: 5'-GCACTCGTACCTGTGTCATTCAAC-3',

[0042] The conserved region gene sequence of the CVA2 standard product is as follows:

[0043] AAAATAGTGTGGAAGAGGCTAGTATAAACCACTTCTTCTCCCGAGCAGCTTTGGTTGGTAAGGTGGAGTTGAATGACACAGGTACGAGTGC

[0044] The above primers and positive control standards were...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of virus detection and particularly relates to a CVA2 specific primer, a real-time fluorescence detection kit and use of the real-time fluorescence detection kit. The kit contains RT-PCR reaction liquid, CVA2 strong positive control reference substance, a CVA2 weak positive control reference substance and a negative quality control standard substance, wherein the RT-PCR reaction liquid contains an RT-PCR buffer solution, a fluorescent dye, a mixture of magnesium ions and triphosphoric acid deoxyribonucleotide, ExTaqHSDNA polymerase, PrimeScript reverse transcriptase, an RNase inhibitor and a CVA2 specific primer. The kit provided by the invention has good specificity and does not generate cross reaction with positive nucleic acids of types 5, 6,10 and the like of a group A of Coxsackie virus, type 1, 3 and the like of a group B of Coxsackie virus, influenza virus A, respiratory syncytial virus, bocavirus and the like.

Description

technical field [0001] The invention relates to the technical field of virus detection, in particular to a CVA2-specific primer, a real-time fluorescence detection kit and applications thereof. Background technique [0002] Hand-foot-and-mouth disease (HFMD) is a common infectious disease caused by a variety of enteroviruses, clinically manifested as herpes in the hands, feet, mouth and other parts and infants with central nervous system complications disease. Hand, foot and mouth disease has caused multiple outbreaks and epidemics worldwide, especially since the 1990s in the Asia-Pacific region, causing multiple outbreaks, among which enterovirus 71 (EV71) and coxsackie virus A16 (CAV16) is the most common. Children under the age of 15 are particularly susceptible to HFMD, and most patients present with a self-limited, usually fever, skin eruption on the hands and feet and oral vesicles. However, a small number of people can quickly develop fatal neurological and systemi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11C12R1/93
CPCC12Q1/701C12Q1/686C12Q2563/107C12Q2521/107C12Q2545/113
Inventor 钟柏茂陆小梅马强彭琪李文瑞
Owner 东莞市第八人民医院
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com