HPK1-targeted gRNA and editing method of HPK1 gene

A targeting and gene technology, applied in the fields of molecular biology and immunology, can solve the problems of complex operation, enhanced killing activity of T cell hpk1 gene, and high technical requirements

Active Publication Date: 2019-03-26
BEIJING YUFAN BIOTECH CO LTD
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the operation of knocking out the hpk1 gene in T cells is complex, requires high technical requirements, and has low knockout efficiency. In the prior art, there is no report on the successful use of CRISPR / CAS technology to knock out the hpk1 gene in T cells to enhance its killing activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HPK1-targeted gRNA and editing method of HPK1 gene
  • HPK1-targeted gRNA and editing method of HPK1 gene
  • HPK1-targeted gRNA and editing method of HPK1 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0107] Design and synthesis of embodiment 1 gRNA

[0108] 1. Design of Guide RNA

[0109] The gRNA loading plasmid is pUC57kan-T7-gRNA, the gRNA targeting HPK1 is designed, and the gRNA targeting PD1 is used as a control. The sequence of the gRNA specifically targeting HPK1 and the genome is GACCTGGTGGCACTGAAGA (located in the second exon of HPK1, SEQ ID NO: 1); the sequence of the gRNA specifically targeting PD1 paired with the genome is GGCCAGGATGGTTCTTAGGT (located in the first exon of PD1 exon, SEQ ID NO: 2).

[0110] HPK1 gRNA: F:5'-TAGG GACCTGGTGGCACTGAAGA-3' (SEQ ID NO:3)

[0111] R: 5'-AAAC TCTTCAGTGCCACCAGGTC-3' (SEQ ID NO: 4).

[0112] PD1gRNA: F: 5'-TAGG GGCCAGGATGGTTCTTAGGT-3' (SEQ ID NO: 5)

[0113] R: 5'-AAAC ACCTAAGAACCATCCTGGCC-3' (SEQ ID NO: 6).

[0114] Synthesize the gRNA coding strand and complementary strand according to the above sequence, and insert the double-stranded DNA template formed by the annealing of the two DNA strands of HPK1gRNA and PD1gR...

Embodiment 2

[0117] Example 2 Recombinant expression and purification of Cas9 protein

[0118] The loading plasmid of Cas9 is PGEX4T-1, and the codon-optimized full-length human cas9cDNA is obtained by PCR. The template is the plasmid PUC19-T7-CAS9, and nuclear localization signals are added to the 5' and 3' ends of the Cas9 sequence (NLS) to promote the nuclear import of cas9 protein.

[0119] After the plasmid was constructed successfully, express the CAS9 protein with E.col, purify it through a GST column, concentrate and collect the protein, and cut off the GST tag with thrombin, an obvious single protein band can be seen around the 160kd band ( figure 2 ).

Embodiment 3

[0120] Example 3 In vitro expansion and transfection of human peripheral blood mononuclear cells

[0121] by using Extraction of human peripheral blood mononuclear cells by centrifugation and rapid separation of formazan sodium solution. CD3-positive peripheral blood mononuclear cells were sorted out with CD3 magnetic beads, and T cells were activated with CD3 / 28 antibody, with LONZA-X-VIVO 15 medium containing 100U / ml IL-2 at 37°C / 5% CO 2 The virus transfection and electroporation of the cells were carried out after culturing the cells under the condition of 2 days.

[0122] After cas9 protein and gRNA mRNA were mixed in proportion, they were left at room temperature for 10 minutes, while 4.0×10 6 CD3+ T cells (after CD3 / CD28 antibody activation in vitro for 48 hours) were transferred to a 15ml centrifuge tube, centrifuged at 500×g for 5 minutes, resuspended with 400ulopti-medium (containing cas9 and gRNA mixture), and transferred the cell mixture to the gap Place the ele...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to HPK1-targeted gRNA and an editing method aiming at an HPK1 gene. According to HPK1gRNA and the editing method of the HPK1 gene, the HPK1 gene of the T cell can be knocked out,the killing activity of the T cell can be improved, the Th1 cell factor level of a peripheral blood monouclear cell can be increased; and by knocking out the HPK1 gene of the T cell, the expression of PD-1 and TIM3 on the surface of the T cell can be decreased, and the failure of the T cell can be inhibited. Therefore, HPK1-targeted gRNA can be used for preparing tumor treatment drug and can be particularly applied to targeting therapy methods (CRA-T, CAR-NK, CAR-NKT and CAR-gammadelta) for chimeric antigen receptor cell tumors.

Description

technical field [0001] The present invention belongs to the technical field of molecular biology and immunology, and specifically relates to cancer immunotherapy, in particular to a gRNA targeting HPK1, a gene editing method for HPK1, and peripheral blood mononuclear cells after gene editing, such as T cells , NK cells and NKT cell activities were enhanced, and the expressions of PD-1 and TIM3 were decreased. Background technique [0002] Tumor is one of the major diseases that threaten human health. In recent years, immunotherapy against tumor has gradually become a research hotspot in tumor treatment. Tumor immune cell therapy is to modify, cultivate and expand immune cells collected from the human body in vitro, and then reinfuse them into the patient's body to stimulate and enhance the body's own immune function, so as to achieve the effect of inhibiting tumor growth and killing tumor cells. [0003] Among many cancer immune cell therapy methods, chimeric antigen recept...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/10C12N9/22C07K19/00C12N15/85C12N5/10A61P35/00
CPCC07K14/7051C12N5/0645C12N9/12C12N9/22C12N15/1137C12N15/85C12Y207/11C07K2319/00C12N2310/10C12N2510/00C12N2800/80C12N2810/10A61K39/464406A61K2239/48A61K2239/59A61K39/4611A61K39/464412A61K2239/38A61K39/4631C12N5/0636A61K2239/31A61K39/464417C12N15/10A61P35/00C12N2310/20C12Y207/11001C07K2319/09C07K2319/21C07K2319/23C07K2319/24C07K2319/50C12N15/90A61P37/04C07K2319/03A61K2121/00A61K2300/00
Inventor廖学斌司静文
OwnerBEIJING YUFAN BIOTECH CO LTD