Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

FnCpf1 mediated in-vitro DNA editing kit

A kit and cpf1 technology, applied in the field of molecular biology, can solve the problems of complicated and time-consuming operation, limited flexible application, etc.

Active Publication Date: 2019-04-09
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the independent operation of enzyme digestion and ligation requires not only the purification of DNA fragments, but also the additional recovery of in vitro RNA transcription, which makes the operation complicated and time-consuming
In addition, the recognition range of FnCpf1 is limited to TTN, which limits its flexible application to a certain extent.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • FnCpf1 mediated in-vitro DNA editing kit
  • FnCpf1 mediated in-vitro DNA editing kit
  • FnCpf1 mediated in-vitro DNA editing kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] Example 1 DNA connection method based on CRISPR / Cpf1 system

[0082] One, the test kit and method of iCOPA of the present invention

[0083] 1. Add sample

[0084]

[0085] Among them, the carrier and the linearized insert have a CrRNA recognition cutting region that guides the Cpf1 enzyme, and the CrRNA recognition cutting region is formed by connecting a PAM site and a spacer with a length of 23 bp;

[0086] CrRNA template DNA: composed of T7 promoter, DR, spacer sequence;

[0087] DR is 19 or 36nt, and the spacer sequence length is 23nt;

[0088] T7 promoter sequence: GAAATTAATACGACTCACTATAGG;

[0089] 19nt DR sequence: AATTTCTACTGTTGTAGAT;

[0090] 36nt DR sequence: GTCTAAGAACTTTAAATAATTTCTACTGTTGTAGAT;

[0091] The number of CrRNA template DNA is more than 1, and the spacer sequence is consistent with the 23nt length recognition region on the vector and the insert fragment respectively.

[0092] The transcription mixture (available from Tiangen Company) co...

Embodiment 2

[0133] Example 2 Screening experiment of the DNA connection method based on the CRISPR / Cpf1 system of the present invention

[0134] 1. Optimizing the conditions for in vitro shearing of Cpf1

[0135] Wild-type FnCpf1 tends to cleave TTV PAM more than TTT). In order to obtain a suitable balance of reaction conditions corresponding to PAMTTN, to facilitate the universality and efficiency of subsequent toolbox experiment design. We first selected two groups of spacers (E-SP3: TTT PAM; E-SP15: TTA PAM) for in vitro enzyme activity testing. Linearized DNA T PAM 1 and T Red 1 were used as digestion substrates corresponding to spacer E-SP3 and spacer E-SP15, respectively. The sheared product fragments are 527bp and 707bp or 802bp and 2233bp, respectively.

[0136] According to the aforementioned system, perform the following screening to determine the parameters of the CRISPR / Cpf1 system:

[0137] 1. Test the effect of crRNA concentration on shearing efficiency, including 10nM...

experiment example 1

[0141] Experimental Example 1 Editing using the kit of the present invention: inserting fragments based on FnCpf1

[0142] The purpose of the experiment: add the promoter plac before the fluorescent protein expression gene mRFP, thereby activating the expression of the fluorescent protein mRFP;

[0143] 1. Select the spacer on the original vector, and design the corresponding spacer that can be applied to the promoter

[0144] (Table 1-1)

[0145] Table 1-1 The spacer applied to mRFP fluorescent protein activation

[0146]

[0147] 2. Obtain crRNA by PCR to prepare substrate template DNA

[0148] According to the requirements of the T7 transcription kit, design the corresponding primers (Table 1-2)

[0149] Table 1-2 is used to prepare substrate template DNA for crRNA activated by mRFP

[0150]

[0151] The obtained primers were used for PCR enrichment, and the enzyme used was Q5 high-fidelity enzyme (NEB Company, product number M0491). The specific configuration sy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an FnCpf1 or FnCpf1 mutant mediated in-vitro DNA editing kit. Transcription of crRNA and digestion-ligation reactions are combined in the same reaction mixture, and assembly ofa carrier and a target fragment is realized by one step. Furthermore, an FnCpf1 mutant with wider PAM recognition range is obtained, PAM can be recognized as 60 / 64(PAM-NNN), YN, TAA, TAC, TGC and CAAwhich can be applied to the editing scheme are selected, and the recognition range of FnCpf1 is expanded four times. Due to the advantages of Cpf1, one digestive enzyme is just required in the methodand can replace various types of restriction endonuclease at present without sequence dependency, and meanwhile, the digestion and ligation reactions are performed by one step. A CRISPR in-vitro editing system with wide DNA target range is provided and can be taken as an effective one-step reaction seamless editing tool.

Description

technical field [0001] The invention belongs to the field of molecular biology, and in particular relates to a FnCpf1-mediated in vitro DNA editing kit. Background technique [0002] The discovery of type II restriction restriction endonuclease (RE) has promoted the development and application of DNA recombination technology. Subsequently, the rapid development of synthetic biology has triggered the need for flexible and versatile in vitro DNA assembly / editing strategies. In vitro DNA assembly / editing methods can be divided into two categories: restriction enzyme ligation and homologous sequence-guided homologous recombination. Currently, the most commonly used restriction endonuclease-based ligation and Golden Gate assembly (Carola, Romy et al. 2008, Engler, Gruetzner et al. 2009). Golden Gate is a one-step cloning method based on IIS restriction enzymes and has been optimized for sequential assembly of multi-fragment DNA (Werner, Engler et al. 2012). However, for a give...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/90
CPCC12N15/113C12N15/70C12N15/902C07K14/195C12N2310/20C12N2310/10
Inventor 罗云孜王丽苹王浩君
Owner WEST CHINA HOSPITAL SICHUAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com