Detection method and detection kit for oligonucleotides of leukemia MEF2D-BCL9 fusion gene at different sites
A technology that combines genes and kits, applied in the fields of life sciences and biology, can solve the problems of high cost and low specificity, and achieve high accuracy, reduce false negatives and false positives, and low false positives
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] The preparation of embodiment 1 kit
[0069] 1. Design of Specific Primers and Probes
[0070] Specific probes and primers were designed according to gene sequences (ABL1 gene sequence, MEF2D-BCL9 gene sequence and their partner gene sequences were all from the National Center for Biotechnology Information Nucleic Acid Database).
[0071] ABL1 gene ID: 25, gene reference sequence NM_005157.6;
[0072] MEF2D gene ID: 4209, gene reference sequence: NM_001271629.1;
[0073] BCL9 gene ID: 607, gene reference sequence: NM_004326.4.
[0074] 2. Preparation of kit components
[0075] Primers and probes: including detection of MEF2D-BCL9 fusion genes at different sites and internal reference ABL1 primers and probes corresponding to the primers, as follows:
[0076] 202-968-F: GCAGCCAGCACTACAGAGGA SEQ ID No. 1
[0077] 202-968-R: CTCTGGAGGCATGGTATAAGGTGT SEQ ID No. 2
[0078] 202-968-Probe: FAM-CCCCACCTCCTACAGCCAGCC-BHQ1SEQ ID No.3
[0079] 221-968-F: GTGACCTGAACAGTGCTAAC...
Embodiment 2
[0092] Embodiment 2 The operation process of this test kit
[0093]1. Extraction of total RNA in bone marrow: Add 1ml of erythrocyte lysate to a clean 1.5ml centrifuge tube, take 0.5ml of bone marrow and mix well. Let stand at room temperature in the dark for 10 minutes; centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 0.5ml red blood cell lysate again, centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 1ml TRIzol to the cells, and pipette repeatedly until The precipitate was completely dissolved, and stood on ice for 15 minutes; added 0.2ml of chloroform, oscillated evenly, and after standing on ice for 10 minutes, centrifuged at 12000rpm for 15 minutes; absorbed the supernatant and transferred it to another new centrifuge tube; added an equal volume of isopropanol, Mix well up and down, let stand on ice for 10 minutes, then centrifuge at 12000rpm at 4°C for 15min, discard the supe...
Embodiment 3
[0100] Example 3 Detection of leukemia specimens and clinical examination specimens
[0101] 1. A total of 14 bone marrow samples from B-ALL leukemia patients submitted for inspection were taken, and genomic RNA was extracted, reagents were prepared and tested according to the method described in Example 2. Add 2 μl of each sample to the detection system PCR reaction solution. Make positive, negative, and blank controls at the same time. Each sample is repeated twice, one positive control, one negative control, and one blank control. The detection time is only 98 minutes. When the internal reference, positive control, negative control, and blank control were all normal, because the MEF2D-BCL9 fusion gene is relatively rare in leukemia patients, all 14 leukemia samples were negative, that is, none of these 14 patients had MEF2D -Type of BCL9 fusion gene, the results are as follows:
[0102]
[0103] The above results show that the kit can detect samples with high throughp...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com