Unlock instant, AI-driven research and patent intelligence for your innovation.

New strains of the cluster-grown chrysanthemum and its artificial cultivation method and application

A technology of artificial cultivation and new strains, which is applied in cultivation, application, plant cultivation, etc., can solve the problems of limited wild resources of clustered mushrooms and no artificial cultivation of clustered mushrooms, etc.

Active Publication Date: 2021-05-28
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In previous studies, the conditions for artificially cultivating the fruiting bodies of C. tussata were immature, and the wild resources of C. tussula were very limited, so there has been no record of artificial cultivation of C. spp.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New strains of the cluster-grown chrysanthemum and its artificial cultivation method and application
  • New strains of the cluster-grown chrysanthemum and its artificial cultivation method and application
  • New strains of the cluster-grown chrysanthemum and its artificial cultivation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1: Discovery and shape of new bacterial strains of the cluster-grown fungus

[0069] During the collection and investigation of large-scale fungal resources in Baima Grand Canyon, Tiantangzhai National Nature Reserve, Anhui Province, new strains of C. figure 1 and 2 As shown, it was named Hypholoma fasciculare Hmgim-E140855, and it was preserved in the China Center for Type Culture Collection (CCTCC for short, address: Wuhan University, Bayi Road, Hongshan District, Wuhan City) on May 21, 2018. The number is CCTCC No: M2018292.

[0070] Observe its properties as:

[0071] Hypholoma fasciculare (Huds.) P.Kumm.≡Naematoloma fasciculare (Huds.) P.Karst. Cap diameter 0.3-4cm, initial conical to bell-shaped, nearly hemispherical to flat, central blunt to slightly pointed, Sulfur yellow to slightly reddish-brown to orange-brown at the top of the lid, smooth, sulfur-yellow to grayish-sulphur-yellow at the lid edge, and absorb water until slightly water-stained, easil...

Embodiment 2

[0072] Molecular Biological Identification of New Strain of Crowded Filamentous Capsules in Example 2

[0073] On July 10, 2014, Hu Huiping, Liu Yuanchao, Cao Renrun, and Wu Lixia conducted large-scale fungal resource collection and investigation in Baima Grand Canyon, Tiantangzhai National Nature Reserve, Anhui. The pure culture of PDA was obtained by tissue separation method, the mycelium was collected by liquid culture, dried at low temperature (40°C), ground with liquid nitrogen, and the DNA genome was extracted by using the Ezup column type fungal genome DNA extraction kit. The DNA solution was refrigerated at -20°C for later use.

[0074] The ITS-PCR experiment was carried out by the general primer ITS1 / ITS4 (ITS1:TCCGTAGGTGAACCTGCGG, ITS4:TCCTCCGCTTATTGATATGC) of the fungal ribosomal intergenic region, and the composition of the PCR reaction solution (50 μl in total) was:

[0075]

[0076] The reaction conditions were: 94°C for 5 minutes; 94°C for 1 minute, 55°C for...

Embodiment 3

[0078] The artificial cultivation of embodiment 3 clustered mushroom new bacterial strains:

[0079] 1. Culture medium:

[0080] 1. Separation of mother seed culture medium

[0081] Potato 20% + Glucose 2% + Agar 2% + Potassium dihydrogen phosphate 0.3% + Magnesium sulfate 0.15% + Vitamin B 1 Trace amount, the rest is water.

[0082] 2. Purified mother culture medium

[0083] Peptone 0.5% + glucose 1% + potassium dihydrogen phosphate 0.1% + magnesium sulfate (MgSO4·7H2O) 0.05% + agar 2% + 1 / 3000 Bengal red solution 10% + chloramphenicol 0.01%, the rest is water.

[0084] 3. Production medium for mother species

[0085] Potato 20% + Glucose 2% + Peptone 1% + Agar 2% + Potassium dihydrogen phosphate 0.3% + Magnesium sulfate 0.15% + Vitamin B 1 Trace amount, the rest is water.

[0086] 4. Production medium

[0087] 98-99% sorghum + 1-2% calcium carbonate

[0088] 5. Artificial domestication medium

[0089] 30-31% cottonseed hulls + 57-58% sawdust + 10% bran + 1-2% CaCO3....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The present invention relates to a new strain of rare medicinal fungus and its artificial cultivation method, in particular to a new strain of fungal mushrooms in clusters and its artificial cultivation method. The new strain of Hypholoma fasciculare Hmgim‑E140855 was collected from humus soil during the collection and investigation of large-scale fungal resources in Baima Grand Canyon, Tiantangzhai National Nature Reserve, Anhui. On May 21, 2018, it was deposited in the China Center for Type Culture Collection (CCTCC for short, address: Wuhan University, Bayi Road, Hongshan District, Wuhan City) and the preservation number is CCTCC No: M2018292. The present invention finds that the clustered chrysanthemum strain has a significant effect of inhibiting the growth of various species of Armillaria genus, has a potential forest protection function, and is expected to be developed into a bio-control fungus for forest protection.

Description

technical field [0001] The present invention relates to a new strain of rare medicinal fungus and its artificial cultivation method, in particular to a new strain of fungal mushrooms in clusters and its artificial cultivation method. Background technique [0002] At present, the industry of edible and medicinal fungi is developing rapidly. According to statistics, the output of edible and medicinal fungi in my country reached 34.76 million tons in 2015, with an output value of more than 251.6 billion yuan, accounting for more than 70% of the world, and more than 20 million employees. In the planting industry, it ranks fifth after grain, cotton, oil, and vegetables, surpassing fruit, tea, and sericulture. [0003] Today, with the vigorous development of the edible and medicinal mushroom industry, more and more rare edible and medicinal mushroom varieties have gradually entered people's field of vision, and many original rare varieties have gradually been domesticated, such as ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/14
CPCA01G13/00A01G18/00A01G18/20
Inventor 胡惠萍谢意珍刘远超莫伟鹏梁晓薇
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY