New strains of the cluster-grown chrysanthemum and its artificial cultivation method and application
A technology of artificial cultivation and new strains, which is applied in cultivation, application, plant cultivation, etc., can solve the problems of limited wild resources of clustered mushrooms and no artificial cultivation of clustered mushrooms, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1: Discovery and shape of new bacterial strains of the cluster-grown fungus
[0069] During the collection and investigation of large-scale fungal resources in Baima Grand Canyon, Tiantangzhai National Nature Reserve, Anhui Province, new strains of C. figure 1 and 2 As shown, it was named Hypholoma fasciculare Hmgim-E140855, and it was preserved in the China Center for Type Culture Collection (CCTCC for short, address: Wuhan University, Bayi Road, Hongshan District, Wuhan City) on May 21, 2018. The number is CCTCC No: M2018292.
[0070] Observe its properties as:
[0071] Hypholoma fasciculare (Huds.) P.Kumm.≡Naematoloma fasciculare (Huds.) P.Karst. Cap diameter 0.3-4cm, initial conical to bell-shaped, nearly hemispherical to flat, central blunt to slightly pointed, Sulfur yellow to slightly reddish-brown to orange-brown at the top of the lid, smooth, sulfur-yellow to grayish-sulphur-yellow at the lid edge, and absorb water until slightly water-stained, easil...
Embodiment 2
[0072] Molecular Biological Identification of New Strain of Crowded Filamentous Capsules in Example 2
[0073] On July 10, 2014, Hu Huiping, Liu Yuanchao, Cao Renrun, and Wu Lixia conducted large-scale fungal resource collection and investigation in Baima Grand Canyon, Tiantangzhai National Nature Reserve, Anhui. The pure culture of PDA was obtained by tissue separation method, the mycelium was collected by liquid culture, dried at low temperature (40°C), ground with liquid nitrogen, and the DNA genome was extracted by using the Ezup column type fungal genome DNA extraction kit. The DNA solution was refrigerated at -20°C for later use.
[0074] The ITS-PCR experiment was carried out by the general primer ITS1 / ITS4 (ITS1:TCCGTAGGTGAACCTGCGG, ITS4:TCCTCCGCTTATTGATATGC) of the fungal ribosomal intergenic region, and the composition of the PCR reaction solution (50 μl in total) was:
[0075]
[0076] The reaction conditions were: 94°C for 5 minutes; 94°C for 1 minute, 55°C for...
Embodiment 3
[0078] The artificial cultivation of embodiment 3 clustered mushroom new bacterial strains:
[0079] 1. Culture medium:
[0080] 1. Separation of mother seed culture medium
[0081] Potato 20% + Glucose 2% + Agar 2% + Potassium dihydrogen phosphate 0.3% + Magnesium sulfate 0.15% + Vitamin B 1 Trace amount, the rest is water.
[0082] 2. Purified mother culture medium
[0083] Peptone 0.5% + glucose 1% + potassium dihydrogen phosphate 0.1% + magnesium sulfate (MgSO4·7H2O) 0.05% + agar 2% + 1 / 3000 Bengal red solution 10% + chloramphenicol 0.01%, the rest is water.
[0084] 3. Production medium for mother species
[0085] Potato 20% + Glucose 2% + Peptone 1% + Agar 2% + Potassium dihydrogen phosphate 0.3% + Magnesium sulfate 0.15% + Vitamin B 1 Trace amount, the rest is water.
[0086] 4. Production medium
[0087] 98-99% sorghum + 1-2% calcium carbonate
[0088] 5. Artificial domestication medium
[0089] 30-31% cottonseed hulls + 57-58% sawdust + 10% bran + 1-2% CaCO3....
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


