Novel strain of hypholoma fasciculare, artificial cultivation method and application thereof
A technology of artificial cultivation and clustering, applied in cultivation, application, plant cultivation, etc., which can solve the problems of no artificial cultivation of clustered umbrellas and limited wild resources of clustered umbrellas
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Embodiment 1: the discovery and the shape of the new bacterial species of the clustered algal mushroom
[0069] During the collection and investigation of large-scale fungal resources in Baima Grand Canyon, Tiantangzhai National Nature Reserve, Anhui Province, new fungus species of C. figure 1 and 2 As shown, it is named Hypholoma fasciculare Hmgim-E140855, and it has been preserved in the China Center for Type Culture Collection (CCTCC for short, address: Wuhan University, Bayi Road, Hongshan District, Wuhan City) on May 21, 2018. The preservation number is CCTCC No: M2018292.
[0070] Observe its properties as:
[0071] Hypholoma fasciculare (Huds.) P.Kumm.≡Naematoloma fasciculare (Huds.) P.Karst. Cap diameter 0.3-4cm, initial conical to bell-shaped, nearly hemispherical to flat, central blunt to slightly pointed, Sulfur yellow to slightly reddish-brown to orange-brown at the top of the lid, smooth, sulfur-yellow to grayish-sulphur-yellow at the lid edge, and absor...
Embodiment 2
[0072] Molecular biological identification of the new bacterial species of the clustered mushrooms of embodiment 2
[0073] On July 10, 2014, Hu Huiping, Liu Yuanchao, Cao Renrun, and Wu Lixia conducted large-scale fungal resource collection and investigation in Baima Grand Canyon, Tiantangzhai National Nature Reserve, Anhui. The pure culture of PDA was obtained by tissue separation method, the mycelium was collected by liquid culture, dried at low temperature (40°C), ground with liquid nitrogen, and the DNA genome was extracted by using the Ezup column type fungal genome DNA extraction kit. The DNA solution was refrigerated at -20°C for later use.
[0074] The ITS-PCR experiment was carried out by using the universal primer ITS1 / ITS4 (ITS1:TCCGTAGGTGAACCTGCGG, ITS4:TCCTCCGCTTATTGATATGC) for the fungal ribosomal intergenic region. The composition of the PCR reaction solution (50 μl in total) was:
[0075] TaKaRaTaq (5units / μl) 0.25μl
[0076] 10×PCR Buffer 5μl
[0077] dNTP...
Embodiment 3
[0084] The artificial cultivation of embodiment 3 tufted mushroom new strains:
[0085] 1. Culture medium:
[0086] 1. Separation of mother seed culture medium
[0087] Potato 20% + glucose 2% + agar 2% + potassium dihydrogen phosphate 0.3% + magnesium sulfate 0.15% + vitamin B1 trace, the rest is water.
[0088] 2. Purified mother culture medium
[0089] Peptone 0.5% + glucose 1% + potassium dihydrogen phosphate 0.1% + magnesium sulfate (MgSO 4 ·7H 2 (0) 0.05%+agar 2%+1 / 3000 Bengal red solution 10%+chloramphenicol 0.01%, and the rest is water.
[0090] 3. Production medium for mother species
[0091] Potato 20% + glucose 2% + peptone 1% + agar 2% + potassium dihydrogen phosphate 0.3% + magnesium sulfate 0.15% + vitamin B1 trace, the rest is water.
[0092] 4. Production medium
[0093] 98-99% sorghum + 1-2% calcium carbonate
[0094] 5. Artificial domestication medium
[0095] 30-31% cottonseed hull + 57-58% sawdust + 10% bran + 1-2% CaCO 3 . Moisture 60%-65%, pH n...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


