Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel strain of hypholoma fasciculare, artificial cultivation method and application thereof

A technology of artificial cultivation and clustering, applied in cultivation, application, plant cultivation, etc., which can solve the problems of no artificial cultivation of clustered umbrellas and limited wild resources of clustered umbrellas

Active Publication Date: 2019-04-16
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY +1
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In previous studies, the conditions for artificially cultivating the fruiting bodies of C. tussata were immature, and the wild resources of C. tussula were very limited, so there has been no record of artificial cultivation of C. spp.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel strain of hypholoma fasciculare, artificial cultivation method and application thereof
  • Novel strain of hypholoma fasciculare, artificial cultivation method and application thereof
  • Novel strain of hypholoma fasciculare, artificial cultivation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Embodiment 1: the discovery and the shape of the new bacterial species of the clustered algal mushroom

[0069] During the collection and investigation of large-scale fungal resources in Baima Grand Canyon, Tiantangzhai National Nature Reserve, Anhui Province, new fungus species of C. figure 1 and 2 As shown, it is named Hypholoma fasciculare Hmgim-E140855, and it has been preserved in the China Center for Type Culture Collection (CCTCC for short, address: Wuhan University, Bayi Road, Hongshan District, Wuhan City) on May 21, 2018. The preservation number is CCTCC No: M2018292.

[0070] Observe its properties as:

[0071] Hypholoma fasciculare (Huds.) P.Kumm.≡Naematoloma fasciculare (Huds.) P.Karst. Cap diameter 0.3-4cm, initial conical to bell-shaped, nearly hemispherical to flat, central blunt to slightly pointed, Sulfur yellow to slightly reddish-brown to orange-brown at the top of the lid, smooth, sulfur-yellow to grayish-sulphur-yellow at the lid edge, and absor...

Embodiment 2

[0072] Molecular biological identification of the new bacterial species of the clustered mushrooms of embodiment 2

[0073] On July 10, 2014, Hu Huiping, Liu Yuanchao, Cao Renrun, and Wu Lixia conducted large-scale fungal resource collection and investigation in Baima Grand Canyon, Tiantangzhai National Nature Reserve, Anhui. The pure culture of PDA was obtained by tissue separation method, the mycelium was collected by liquid culture, dried at low temperature (40°C), ground with liquid nitrogen, and the DNA genome was extracted by using the Ezup column type fungal genome DNA extraction kit. The DNA solution was refrigerated at -20°C for later use.

[0074] The ITS-PCR experiment was carried out by using the universal primer ITS1 / ITS4 (ITS1:TCCGTAGGTGAACCTGCGG, ITS4:TCCTCCGCTTATTGATATGC) for the fungal ribosomal intergenic region. The composition of the PCR reaction solution (50 μl in total) was:

[0075] TaKaRaTaq (5units / μl) 0.25μl

[0076] 10×PCR Buffer 5μl

[0077] dNTP...

Embodiment 3

[0084] The artificial cultivation of embodiment 3 tufted mushroom new strains:

[0085] 1. Culture medium:

[0086] 1. Separation of mother seed culture medium

[0087] Potato 20% + glucose 2% + agar 2% + potassium dihydrogen phosphate 0.3% + magnesium sulfate 0.15% + vitamin B1 trace, the rest is water.

[0088] 2. Purified mother culture medium

[0089] Peptone 0.5% + glucose 1% + potassium dihydrogen phosphate 0.1% + magnesium sulfate (MgSO 4 ·7H 2 (0) 0.05%+agar 2%+1 / 3000 Bengal red solution 10%+chloramphenicol 0.01%, and the rest is water.

[0090] 3. Production medium for mother species

[0091] Potato 20% + glucose 2% + peptone 1% + agar 2% + potassium dihydrogen phosphate 0.3% + magnesium sulfate 0.15% + vitamin B1 trace, the rest is water.

[0092] 4. Production medium

[0093] 98-99% sorghum + 1-2% calcium carbonate

[0094] 5. Artificial domestication medium

[0095] 30-31% cottonseed hull + 57-58% sawdust + 10% bran + 1-2% CaCO 3 . Moisture 60%-65%, pH n...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a novel strain of rare medicinal fungi and an artificial cultivation method thereof, in particular to a novel strain of hypholoma fasciculare and an artificial cultivation method thereof. When the novel strain of the hypholoma fasciculare is collected and investigated on the humus soil in the Baima Grand Canyon of Tiantangzhai National Nature Reserve, Anhui Province, the novel strain named as hypholoma faciculare Hmgim-E140855, the strain is preserved in China Center for Type Culture Collection (CCTCC for short, address: Wuhan University, Bayi Road, Hongshan District,Wuhan Dity) on May 21, 2018, and the preservation number is CCTCC No: M2018292. According to the invention, the stain of the hypholoma fasciculare has an obvious effect of inhibiting the growth of various species of armillaria, has a potential forest protection function, and is expected to be developed into biocontrol fungi for forest protection.

Description

technical field [0001] The invention relates to a new strain of rare medicinal fungus and an artificial cultivation method thereof, in particular to a new strain of chrysomycetes and an artificial cultivation method thereof. Background technique [0002] At present, the industry of edible and medicinal fungi is developing rapidly. According to statistics, the output of edible and medicinal fungi in my country reached 34.76 million tons in 2015, with an output value of more than 251.6 billion yuan, accounting for more than 70% of the world, and more than 20 million employees. In the planting industry, it ranks fifth after grain, cotton, oil, and vegetables, surpassing fruit, tea, and sericulture. [0003] Today, with the vigorous development of the edible and medicinal mushroom industry, more and more rare edible and medicinal mushroom varieties have gradually entered people's field of vision, and many original rare varieties have gradually been domesticated, such as bamboo fu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01G18/00A01G18/20A01G13/00
CPCA01G13/00A01G18/00A01G18/20
Inventor 胡惠萍谢意珍刘远超莫伟鹏梁晓薇
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products