Unlock instant, AI-driven research and patent intelligence for your innovation.

Triple fluorescent quantitative PCR primer and probe for detecting three sheep pathogenic mycoplasmas

A fluorescent quantitative and fluorescent probe technology, applied in biochemical equipment and methods, microorganisms, recombinant DNA technology, etc., to achieve strong specificity, cost savings, and good repeatability.

Inactive Publication Date: 2019-04-23
INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
View PDF8 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The technical problem to be solved by the present invention is to provide a method based on application-specific primers that can quickly, accurately, A Triple Fluorescent Quantitative PCR Method for the Simultaneous Detection of These Three Mycoplasma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Triple fluorescent quantitative PCR primer and probe for detecting three sheep pathogenic mycoplasmas
  • Triple fluorescent quantitative PCR primer and probe for detecting three sheep pathogenic mycoplasmas
  • Triple fluorescent quantitative PCR primer and probe for detecting three sheep pathogenic mycoplasmas

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] A triple fluorescence quantitative PCR method for three kinds of sheep pathogenic Mycoplasma, including:

[0074] (1) Design and synthesis of primers and probes:

[0075] According to Mo published on GenBank p113 Gene, Mmc MLC_1770 Gene and Mccp arcA Gene sequence, using Beacon Designer 7.9 software, combined with NCBI Blast online analysis, respectively, designed three pairs of specific primers and probes for Mo, Mmc and Mccp, the specific primers and probes designed to detect Mycoplasma ovis pneumoniae sequence are respectively :

[0076] Upstream primer Mo-F: 5’-CTTCGGGACTTATTGGAG-3’;

[0077] Downstream primer Mo-R: 5’-GATGCAAACTGATTTACTTG-3’;

[0078] Fluorescent probe Mo-P: 5’-ROX- AAGACCGATTGTCAGGCCGA -Eclipse-3’;

[0079] The specific primers and probe sequences designed to detect Mycoplasma mycoplasma goat subspecies are as follows:

[0080] Upstream primer Mmc-F: 5’-CTAGCTAGCATAGTTGTTG-3’;

[0081] Downstream primer Mmc-R: 5’- GCTTGAACAACTATATTGTA -3’;

[0082] Fluoresc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a triple fluorescent quantitative PCR primer and a probe for detecting three sheep pathogenic mycoplasmas, wherein specific detection primers Mo-F, Mo-R and a fluorescent probeMo-P aiming at mycoplasma ovis are respectively designed, specific detection primers Mmc-F, mmc-R and probe Mmc-P aiming at mycoplasma filamentous subspecies of goat are designed, specific detection primers Mccp-F, Mccp-R and fluorescent probe Mccp-P for Mycoplasma goat subspecies of pneumonia. The triple fluorescent quantitative PCR method can simultaneously detect and identify three mycoplasmas,namely mycoplasma sheep pneumonia, mycoplasma goat pneumonia subspecies and mycoplasma filamentous goat subspecies, has the advantages of rapidness, accuracy, strong specificity, good repeatability and the like, can also save cost. The method is suitable for rapid detection of the three mycoplasmas and epidemiological investigation of mycoplasma ovis pneumonia and goat infectious pleuropneumoniacaused by the three mycoplasmas.

Description

Technical field [0001] The invention relates to a triple fluorescence quantitative PCR primer and probe for detecting three kinds of sheep pathogenic mycoplasma, and belongs to the technical field of preventive veterinary medicine. Background technique [0002] In recent years, mycoplasma pneumonia has been prevalent in Xinjiang, Liaoning, Hebei, Sichuan, Chongqing, Guangxi, Guizhou, Hunan, Fujian and other provinces in China. The main pathogens are Mycoplasma ovipneumonia (Mo) and Mycoplasma mycoplasma goat. Species (Mycoplasma mycoides subsp.capri, Mmc). In recent years, many scholars have reported that there are two or more mycoplasma mixed infections in the same sheep. However, the clinical symptoms caused by these two pathogens are similar, and the pathological changes are similar. It is difficult to distinguish clinically, which brings great significance to the diagnosis of the disease. Great difficulty. These two pathogens are the main epidemic diseases in the current sh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/04C12Q1/686C12N15/11C12R1/35
CPCC12Q1/686C12Q1/689C12Q2563/107C12Q2545/114C12Q2537/143
Inventor 林裕胜胡奇林江锦秀游伟张靖鹏
Owner INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI