Triple fluorescent quantitative PCR primer and probe for detecting three sheep pathogenic mycoplasmas
A fluorescent quantitative and fluorescent probe technology, applied in biochemical equipment and methods, microorganisms, recombinant DNA technology, etc., to achieve strong specificity, cost savings, and good repeatability.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0073] A triple fluorescence quantitative PCR method for three kinds of sheep pathogenic Mycoplasma, including:
[0074] (1) Design and synthesis of primers and probes:
[0075] According to Mo published on GenBank p113 Gene, Mmc MLC_1770 Gene and Mccp arcA Gene sequence, using Beacon Designer 7.9 software, combined with NCBI Blast online analysis, respectively, designed three pairs of specific primers and probes for Mo, Mmc and Mccp, the specific primers and probes designed to detect Mycoplasma ovis pneumoniae sequence are respectively :
[0076] Upstream primer Mo-F: 5’-CTTCGGGACTTATTGGAG-3’;
[0077] Downstream primer Mo-R: 5’-GATGCAAACTGATTTACTTG-3’;
[0078] Fluorescent probe Mo-P: 5’-ROX- AAGACCGATTGTCAGGCCGA -Eclipse-3’;
[0079] The specific primers and probe sequences designed to detect Mycoplasma mycoplasma goat subspecies are as follows:
[0080] Upstream primer Mmc-F: 5’-CTAGCTAGCATAGTTGTTG-3’;
[0081] Downstream primer Mmc-R: 5’- GCTTGAACAACTATATTGTA -3’;
[0082] Fluoresc...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap