Use of corilagin in preparation of anti-myocardial fibrosis medicines

A technology for myocardial fibrosis and application, which is applied in the field of application of corilagin in the preparation of anti-myocardial fibrosis drugs, can solve the problem of ineffective myocardial fibroblast proliferation, differentiation and abnormal activation, and no anti-myocardial remodeling Or anti-fibrosis drugs and other problems, achieve the effect of alleviating the deterioration of cardiac function, reducing the deterioration of cardiac function, and the effect is remarkable

Active Publication Date: 2019-04-26
WUHAN UNIV
View PDF9 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few drugs that are mainly aimed at anti-myocardial fibrosis in clinical practice. Common drugs for the prevention and treatment of cardiovascular diseases mostly act on cardiomyocytes, which have certain effects on improving cardiomyocyte hypertrophy, apoptosis and necrosis, but have no effect on the proliferation of myocardial fibroblasts. , differentiation, and abnormal activation have little curative effect, and cannot completely block myocardial fibrosis caused by pressure or neurohumoral load
So far, there have been no relevant reports on the application of corilagin in the research of anti-myocardial remodeling or anti-fibrosis drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of corilagin in preparation of anti-myocardial fibrosis medicines
  • Use of corilagin in preparation of anti-myocardial fibrosis medicines
  • Use of corilagin in preparation of anti-myocardial fibrosis medicines

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] [Example 1] Detection of the effects of Corilagin on cardiac function and myocardial fibrosis in mice

[0040] (1) Detection of cardiac function in mice

[0041] Before sampling, the mouse hearts were examined by ultrasound (ultrasound detector parameters: center frequency 10MHz, frame frequency 50Hz, window 75%, depth 4cm) and hemodynamics. The result is as figure 1 As shown in A-D, in the unmedicated mice, the cardiac function deteriorated, the left ventricular wall was thickened, the ejection fraction decreased, and the intraventricular pressure decreased, while the wall thickness, ejection fraction, and intraventricular pressure of the Corilagin-administered mice Both pressures improved (*p<0.05 vs. Veh group, #p<0.05 vs. AB group).

[0042] (2) Detection of myocardial fibrosis in mice

[0043] Real-time quantitative PCR was used to evaluate the transcription of fibrosis-related genes, and picric acid-Sirius red (PSR) staining was used to evaluate the collagen co...

Embodiment 2

[0061] [Example 2] Detection of the effect of Corilagin on oxidative stress in mouse myocardial tissue

[0062] Real-time quantitative PCR was used to evaluate the transcription of antioxidant genes, Western blot was used to evaluate the expression of antioxidant proteins, and 4-HNE immunohistochemical staining was used to evaluate oxidative stress. The result is as figure 2 As shown, the transcription of antioxidant genes such as SOD1, SOD2, GPx and CAT in the myocardium of the non-medicated surgery group decreased, the expressions of SOD1, SOD2 and HO-1 were decreased, and the content of 4-HNE was also decreased. The above indexes of myocardial tissue all rebounded significantly (*p<0.05vs.Veh group, #p<0.05vs.AB group).

[0063] The primer sequences for amplifying antioxidant genes are as follows:

[0064] SOD1:

[0065] F:TGTGCGTGCTGAAGGG

[0066] R: CATACTGATGGACGTGGAAC

[0067] SOD2:

[0068] F: CCGTCCGTGTCGCCGTCCTC

[0069] R: GCCGCGTGGTGCTTGCTGTG

[0070] GPx:...

Embodiment 3

[0077] [Example 3] Detection of the effect of Corilagin on myocardial tissue inflammation in mice

[0078] Real-time quantitative PCR was used to evaluate the transcription of pro-inflammatory and anti-inflammatory genes, and CD68 immunohistochemical staining was used to evaluate the degree of macrophage infiltration. The result is as image 3 As shown, the transcription levels of pro-inflammatory factors IL-6, IL-12, IL-1β, MCP-1 and TNF-α in the non-medicated surgery group were increased, and the transcription levels of anti-inflammatory factors IL-1Rα and IL-10 were decreased. The infiltration of phagocytes was increased; the transcription levels of pro-inflammatory factors and the transcription of anti-inflammatory factors in the myocardial tissue of the Corilagin administration group decreased, and the infiltration of macrophages decreased (*p<0.05vs.Veh group, #p<0.05vs.AB Group).

[0079] The primer sequences for amplifying pro-inflammatory or anti-inflammatory factor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses use of corilagin in preparation of anti-myocardial fibrosis medicines, belonging to the technical field of biological medicine. By constructing an in-vivo myocardial fibrosis model induced by a mouse aortic ligation operation and an in-vitro myocardial fibrosis model of transforming growth factor (TGF)-beta-induced rat suckling CFs for performing experimental study, the results show that the corilagin can regulate macrophage polarization so as to inhibit inflammation, also can down-regulate an interleukin-4 (IL-4) receptor so as to avoid excessive production of TGF-beta, and inhibits the expression of a TGF-beta receptor so as to reduce the activation of cardiac fibroblasts, thereby reducing collagen content and relieving myocardial fibrosis. The corilagin providedby the invention can reduce the myocardial fibrosis caused by long-term stress load, protect heart tissues and inhibit or delay deterioration of heart functions; the corilagin has a significant effectin the aspect of anti-myocardial fibrosis, is little in side effects, and can be used for preparing the anti-myocardial fibrosis medicines.

Description

technical field [0001] The present invention relates to a new use of corylagin or a pharmaceutically acceptable salt thereof, in particular to the use of corylagin or a pharmaceutically acceptable salt thereof in the preparation of an anti-myocardial fibrosis drug. Background technique [0002] Myocardial fibrosis is a common pathological change in cardiovascular disease, which can lead to the disturbance of cardiac mechanical and electrical functions. [0003] Cardiac injury causes neutrophil infiltration, monocyte-macrophage migration and activation, pro-inflammatory factors such as IL-1, IL-6, IL-12, TGF-β, etc. are secreted in large quantities, activate myocardial fibroblasts, induce their activation, Proliferation and differentiation, the content of type I and type III collagen increases and the arrangement is disordered; the change of cell microenvironment changes intracellular metabolism, the surge of oxidation products, the imbalance of oxidative-antioxidant balance,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/7024A61P9/00
CPCA61K31/7024A61P9/00
Inventor 唐其柱万春霞徐蔓黄思慧王辉波
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap