Unlock instant, AI-driven research and patent intelligence for your innovation.

Use of Corilagin in the preparation of anti-myocardial fibrosis drugs

A technology for myocardial fibrosis and application, which is applied in the application field of corilagin in the preparation of anti-myocardial fibrosis drugs, can solve the problem of ineffective myocardial fibroblast proliferation, differentiation and abnormal activation, and no anti-myocardial remodeling Or anti-fibrosis drugs and other problems, to achieve the effect of alleviating the deterioration of heart function, reducing the deterioration of heart function, and less side effects

Active Publication Date: 2021-04-16
WUHAN UNIV
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few drugs that are mainly aimed at anti-myocardial fibrosis in clinical practice. Common drugs for the prevention and treatment of cardiovascular diseases mostly act on cardiomyocytes, which have certain effects on improving cardiomyocyte hypertrophy, apoptosis and necrosis, but have no effect on the proliferation of myocardial fibroblasts. , differentiation, and abnormal activation have little curative effect, and cannot completely block myocardial fibrosis caused by pressure or neurohumoral load
So far, there have been no relevant reports on the application of corilagin in the research of anti-myocardial remodeling or anti-fibrosis drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of Corilagin in the preparation of anti-myocardial fibrosis drugs
  • Use of Corilagin in the preparation of anti-myocardial fibrosis drugs
  • Use of Corilagin in the preparation of anti-myocardial fibrosis drugs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] [Example 1] Detection of Corilagin's Effects on Mouse Heart Function and Myocardial Fibrosis

[0040] (1) Mouse heart function test

[0041] Before sampling, the mouse heart was subjected to ultrasonic testing (ultrasonic testing instrument parameters: center frequency 10 MHz, burst frequency 50 Hz, window 75%, depth 4 cm) and hemodynamic testing. The result is as figure 1 As shown in A-D, the cardiac function of the mice in the operation group without drugs deteriorated, the left ventricular wall thickened, the ejection fraction decreased, and the intraventricular pressure decreased, while the wall thickness, ejection fraction and intraventricular pressure of the mice in the corilagin-administered group The blood pressure was improved (*p<0.05vs.Veh group, #p<0.05vs.AB group).

[0042] (2) Detection of myocardial fibrosis in mice

[0043] Real-time quantitative PCR was used to evaluate the transcription of fibrosis-related genes, and picric acid-sirius scarlet (PSR)...

Embodiment 2

[0061] [Example 2] Detection of the effect of corilagin on oxidative stress in mouse myocardial tissue

[0062] Real-time quantitative PCR was used to evaluate the transcription of antioxidant genes, Western blot was used to evaluate the expression level of antioxidant proteins, and 4-HNE immunohistochemical staining was used to evaluate oxidative stress. The result is as figure 2 As shown, the transcription of anti-oxidant genes such as SOD1, SOD2, GPx and CAT in the myocardium decreased, the expression of SOD1, SOD2 and HO-1 decreased, and the content of 4-HNE also decreased in the no-drug operation group; while in the corilagin administration group, The above-mentioned indexes of myocardial tissue all showed obvious recovery (*p<0.05vs.Veh group, #p<0.05vs.AB group).

[0063] The primer sequences for amplifying antioxidant genes are as follows:

[0064] SOD1:

[0065] F: TGTGCGTGCTGAAGGG

[0066] R: CATACTGATGGACGTGGAAC

[0067] SOD2:

[0068] F: CCGTCCGTGTCGCCGTCCTC...

Embodiment 3

[0077] [Example 3] Detection of Corilagin's Effect on Myocardial Tissue Inflammation in Mice

[0078] Real-time quantitative PCR was used to evaluate the transcription of pro-inflammatory and anti-inflammatory genes, and CD68 immunohistochemical staining was used to evaluate the degree of macrophage infiltration. The result is as image 3 As shown, the transcription levels of pro-inflammatory factors IL-6, IL-12, IL-1β, MCP-1 and TNF-α were increased, and the transcription levels of anti-inflammatory factors IL-1Rα and IL-10 were decreased in the no-drug operation group. The infiltration of phagocytic cells increased; the transcription levels of pro-inflammatory factors and the transcription of anti-inflammatory factors increased in myocardial tissue of Corilagin administration group, and the infiltration of macrophages decreased (*p<0.05vs.Veh group, #p<0.05vs.AB Group).

[0079] The primer sequences for amplifying pro-inflammatory factors or anti-inflammatory factors are a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the use of corilagin in the preparation of anti-myocardial fibrosis medicine. It belongs to the technical field of biomedicine. The present invention conducts experimental research by constructing an in vivo myocardial fibrosis model caused by mouse aortic ligation and an in vitro myocardial fibrosis model of rat suckling rat CFs induced by TGF-β, and the results show that corilagin can regulate the polarization of macrophages Thereby inhibiting inflammation, while down-regulating IL-4 receptors to avoid excessive production of TGF-β, and reducing the activation of myocardial fibroblasts by inhibiting the expression of TGF-β receptors, thereby reducing collagen content and reducing myocardial fibrosis. The present invention proposes that corilagin can reduce myocardial fibrosis caused by long-term pressure load, protect heart tissue, inhibit or delay the deterioration of cardiac function, has a significant effect in anti-myocardial fibrosis, and has few side effects, and can be used to prepare anti-myocardial fibrosis drugs .

Description

technical field [0001] The present invention relates to a new application of corilagin or a pharmaceutically acceptable salt thereof, in particular to the application of corilagin or a pharmaceutically acceptable salt thereof in the preparation of anti-myocardial fibrosis drugs. Background technique [0002] Myocardial fibrosis is a common pathological change in cardiovascular diseases, which can lead to the disturbance of cardiac mechanical and electrical functions. [0003] Cardiac injury causes neutrophil infiltration, monocyte-macrophage migration and activation, pro-inflammatory factors IL-1, IL-6, IL-12, TGF-β, etc. are secreted in large quantities, activate cardiac fibroblasts, induce their activation, Proliferation and differentiation, the content of type Ⅰ and type Ⅲ collagen increases, and the arrangement is disordered; the change of the cell microenvironment changes the intracellular metabolism, the oxidation product surges, and the oxidation-antioxidation balance...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K31/7024A61P9/00
CPCA61K31/7024A61P9/00
Inventor 唐其柱万春霞徐蔓黄思慧王辉波
Owner WUHAN UNIV