Method for detecting one or more target nucleic acid sequences to be tested by single tube and kit thereof

A nucleic acid sequence and kit technology, applied in the field of molecular biology, can solve problems such as inability to distinguish between specific amplification and non-specific amplification, inability to perform multiple amplifications, unfavorable product promotion, etc., to achieve objective result judgment and high detection results. Effective and reliable, the effect of increased sensitivity

Active Publication Date: 2019-05-14
JIANGSU MACRO&MICRO TEST MED TECH CO LTD
View PDF7 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The judgment methods of isothermal amplification results can basically be divided into three categories: 1. Run agarose gel electrophoresis and observe the gel map; this kind of result judgment method is time-consuming and laborious It is not conducive to product promotion. Generally, it may only be used in the product development stage, but it is basically not used in the actual nucleic acid isothermal detection products to judge the results.
2. Visual observation method to observe the turbidity or color change of the reaction tube before and after amplification; this kind of judgment method is simple and easy, and does not require high requirements for operators. It is a common result judgment method in the market, but its existence cannot distinguish specific Defects of amplification and non-specific amplification and the inability to do multiple amplification
In view of the current clinical needs for simple, fast, high sensitivity, good specificity and multi-target detection technology, and the existing technology has its limitations and cannot fully meet the clinical needs, we urgently need to develop a fast, accurate and low-cost multiple detection technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting one or more target nucleic acid sequences to be tested by single tube and kit thereof
  • Method for detecting one or more target nucleic acid sequences to be tested by single tube and kit thereof
  • Method for detecting one or more target nucleic acid sequences to be tested by single tube and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1 The basic principle of the method of the present invention

[0036] Such as figure 1 As shown, the principle of the method for detecting one or more target nucleic acid sequences to be tested using the fluorescent signal generated by the combination of fluorescent probe (RNHP) and isothermal amplification method in the present invention is as follows figure 1 As shown, the method steps are:

[0037] 1) Design an RNHP for each target nucleic acid sequence to be tested. According to the different isothermal amplification methods used, design specific isothermal amplification primers for each target nucleic acid sequence to be tested, and add the primers and RNHP to the used isothermal amplification Method of the reaction system.

[0038] 2) In the presence of target nucleic acid, as the amplification reaction proceeds, a large amount of target nucleic acid is expanded, and RNHP will bind to the target sequence to form a DNA-RNA hybrid chain. RNaseH can specifically...

Embodiment 2

[0039] Example 2 Results of the detection of Zika virus cRNA gradient dilutions and 1 strain of Zika culture RNA gradient dilutions by the real-time LAMP kit of the present invention

[0040] 1. Design of detection primers

[0041] The detection primers are designed using the relevant nucleic acid sequence of Zika virus published on NCBI and the sequence of the internal reference ACTB gene. The detection primer sequences used in the examples are shown in the following table:

[0042]

[0043] Note: In SEQ ID NO:7 and SEQ ID NO:14 in the above table, underlined bases indicate bases that are labeled with fluorescent groups, lowercase bases indicate RNA bases, and the quencher is labeled 3' On the terminal base.

[0044] 2. Preparation of positive quality control products

[0045] Download the human ACTB gene sequence fragment and the Zika virus NS5 gene sequence fragment from NCBI, respectively, design the primers for the amplification of these two fragments: ACTB-F, ACTB-R; ZK-NS5-F, ZK...

Embodiment 3

[0055] Example 3 Amplification of single-plex real-time LAMP is performed when RNHP is designed at different positions in the LAMP amplification region

[0056] 1. Design of detection primers and probes

[0057] The detection primers are designed using the relevant nucleic acid sequences of Bunya virus published on NCBI. The primers and probe sequences used in the examples are shown in the following table:

[0058]

[0059] Note: In SEQ ID NO: 21-25 in the above table, underlined bases indicate bases labeled with fluorescent groups, lowercase bases indicate RNA bases, and the quencher group is labeled on the 3'end base .

[0060] 2. Preparation of positive quality control products

[0061] Download a fragment of the S segment gene sequence of Bunia virus from NCBI, and design the primers for amplification of this fragment to be Bun-S-F (SEQ ID NO: 30, ATTGCTGCTTACAGGTTTCT) and Bun-S-R (SEQ NO: 31, AGGAAAGACGCAGAGGAGTG). Insert the amplified target fragment of Bunia virus into the pMD1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for detecting one or more target nucleic acid sequences to be tested by a single tube and a kit thereof. The method comprises the steps of designing a specific isothermal amplification primer and a fluorescent probe RNHP for each target nucleic acid sequence to be tested, and labeling each of target nucleic acid sequence fluorescent probes RNHP to be tested with different fluorescence; in the presence of ribonuclease RNaseH, isothermally amplifying each target nucleic acid sequence to be tested by the action of polymerase; forming hybridization chain products labeled with the different fluorescence by the different target nucleic acid sequences to be detected, thereby achieving multiplex detection of the plurality of target nucleic acid sequences to be tested. Based on an isothermal amplification technique, the method can achieve real-time multiplex isothermal detection by introducing a special modified primer RNHP and being combined with RNaseH2.

Description

Technical field [0001] The present invention relates to the technical field of molecular biology, in particular to a method for detecting one or more target nucleic acid sequences to be tested in a single tube and a kit thereof. Background technique [0002] The isothermal nucleic acid amplification method, also known as the isothermal nucleic acid amplification method, is a rapidly developing nucleic acid amplification method since the beginning of the 21st century. Unlike PCR, which requires variable temperature and thermal denaturation to unlock double-stranded amplification, the isothermal nucleic acid amplification method is to rapidly amplify nucleic acid by adding different nucleic acid polymerases and specific primers at a constant temperature. . Isothermal amplification technology can basically achieve the detection of target nucleic acid within 1 hour, and some can even achieve detection within 20 minutes. [0003] The determination methods of isothermal amplification r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6851C12Q1/70
CPCC12Q1/6851C12Q1/70
Inventor刘利成王华贵韦仕卯邹奕君
OwnerJIANGSU MACRO&MICRO TEST MED TECH CO LTD