CRISPR detection primer set for MTBC (Mycobacterium Tuberculosis Complex) and use thereof
A technology for Mycobacterium tuberculosis and detection primers, which is applied in microorganism-based methods, microorganism determination/inspection, microorganisms, etc., can solve problems such as inability to improve sensitivity, and achieve the effect of getting rid of the dependence of precision instruments and having broad application prospects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Design and screening of primer sequences for CRISPR detection of Mycobacterium tuberculosis complex.
[0042] 1. Sequence design.
[0043] 1. Target sequence selection.
[0044] The inventor selected the sequence shown in SEQ ID NO:1 as Mycobacterium tuberculosis (M.tuberculosis), Mycobacterium bovis (M.bovis), African The target sequence of mycobacterium (M.africanum), mycobacterium canneri (M.canettii) and mycobacterium microti (M.microti), which is a conserved sequence of the above-mentioned bacteria, can detect the above-mentioned tuberculosis pathogenic bacteria out. The sequence of SEQ ID NO:1 is as follows:
[0045] AAAGACCGCGTCGGCTTTCTTCGCGGCCGAGCTCGACCGGCCAGCACGCTAATTACCCGGTTCATCGCCGATCATCAGGGCCACCGCGAGGGCCCCGATGGTTTGCGGTGGGGTGTCGAGTCGATCTGCACACAGCTGACCGAGCTGGGTGTGCCGATCGCCCCATCGACCTACTACGACCACATCAACCGGGAGCCCAGCCGCCGCGAGCTGCGCGATGGCGAACTCAAGGAGCACATCAGCCGCGTCCACGCCGCCAACTACGGTGTTTACGGTGCCCGCAAAGTGTGGCTAACCCTGAACCGTGAGGGCATCGAGGTGGCCAGATGCACCGTCGAACGGCTGATGAC...
Embodiment 2
[0082] A test kit for detecting Mycobacterium tuberculosis complex, comprising:
[0083] (1) RPA amplification system:
[0084] RPA amplification primer pair:
[0085] Forward direction: 5'-GGTCGGAAGCTCCTATGACAATGCACTAGCC-3'(SEQ ID NO:4), the concentration is 0.1~1μM
[0086] Reverse: 5'-TTGAGCGTAGTAGGCAGCCTCGAGTTCGAC-3' (SEQ ID NO: 5), the concentration is 0.1-1 μM.
[0087] RPA enzyme master mix: creatine phosphate (concentration 20-80mM), creatine kinase (concentration 50-150mM), dNTPs (concentration 100-300μM), ATP (concentration 20-80mM), DTT (concentration 1-10mM), acetic acid Potassium (concentration 50-200mM), recombinant enzyme uxsX (50-300ng / μL), uxsY (10-100ng / μL), single-chain binding protein (200-1000ng / μL), Bsu polymerase (10-100ng / μL) Wait.
[0088] Magnesium acetate solution: the concentration is 10-20mM
[0089] (2) CRISPR reaction system:
[0090] crRNA: 5'-UAAUUUCUACUAAGUGUAGAUAUCAGCUCGGUCUUGUAUAG-3' (SEQ ID NO:3), the concentration is 20-100nM
[009...
Embodiment 3
[0110] The detection of Mycobacterium tuberculosis complex in clinical samples was carried out with the above kit of Example 2.
[0111] 1. Method
[0112] (1) Sample source: Department of Infectious Diseases, Shanghai Huashan Hospital.
[0113] A total of 120 clinical samples were tested blindly with the GeneXpert detection system widely recognized in the market and the method of the present invention.
[0114] (2) Detection method:
[0115] With reference to the relevant detection steps of the present invention in Example 2, 120 samples were tested.
[0116] 120 samples were detected by referring to the relevant operation instructions of the GeneXpert detection system.
[0117] 2. Results
[0118] The detection results using the two methods are shown in the table below:
[0119] Table 2 The detection results of clinical samples by different methods
[0120]
[0121]
[0122] After calculation, it can be seen that:
[0123] Positive coincidence rate = 97.06%
[...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap