Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleic acid aptamers specifically binding to s100p protein and their screening, identification and application

A nucleic acid aptamer and specific technology, which is applied in the fields of analytical chemistry and medical biology, and can solve the problems that there are no reports of S100P nucleic acid aptamers

Active Publication Date: 2020-08-28
THE FIRST AFFILIATED HOSPITAL OF WENZHOU MEDICAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there are no reports of S100P nucleic acid aptamers at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamers specifically binding to s100p protein and their screening, identification and application
  • Nucleic acid aptamers specifically binding to s100p protein and their screening, identification and application
  • Nucleic acid aptamers specifically binding to s100p protein and their screening, identification and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Screening of S100P-specific nucleic acid aptamers

[0040] The specific steps of the SELEX screening process are as follows:

[0041] a) Forward screening

[0042] Incubate 10 μg of recombinant human S100P protein (6×histidine tag) with appropriate amount of Ni-Sepharose Beads (Ni-Sepharose Beads) at room temperature for 30 min to couple to Sepharose Nickel Beads, Binding Buffer Ⅰ (1% BSA, 0.1% Tween -20, 0.2mg / mL tRNA, DPBS, pH7.4) resuspended for use, washed to remove unbound substances, and this was used as the target for forward screening. The random library synthesized at 5OD (about 14nmol) was denatured at 95°C and cooled slowly to room temperature, then added to the prepared S100P protein-coupled agarose nickel beads and incubated at room temperature for 1 h. Sepharose nickel beads were washed and resuspended with DEPC water, denatured at 95°C for 10 minutes, and centrifuged to collect the supernatant as a template for PCR amplification (95°C for 30s...

Embodiment 2

[0049] Implementation example 2: Identification and performance evaluation of nucleic acid aptamers that can bind to S100P

[0050] a) High-throughput sequencing and secondary structure analysis of high-abundance sequences

[0051] The fifth-round library (2, 4, 5-round library) of nucleic acid aptamers that can bind to S100P was screened and sent to Shanghai Sangong for high-throughput sequencing. After data analysis, a high-abundance sequence was obtained, named AptS100P-1, whose sequence is as follows: figure 1 shown

[0052] 5'-ATCCAGAGTGACGCAGCACAGGACTGCTTAGGATTGCGAAGTGCATAGAGCGGCTATATGGACACGGTGGCTTAGT-3'. Due to the pairing of purine and pyrimidine in the DNA molecule and the electrostatic interaction to form a three-dimensional structure, the secondary structure of AptS100P-1 was predicted by MFold software, as shown in figure 1 As shown, AptS100P-1 consists of two short stem regions and opposite loop regions. From the nature and structure of the nucleic acid aptame...

Embodiment 3

[0064] Example 3: AptS100P-1 inhibits colorectal cancer cell proliferation and metastasis by targeting S100P protein.

[0065] a) Transwell migration assay was used to determine the effect of AptS100P-1 on the migration of SW480 cells and DLD-1 cells.

[0066] Digest the cells with trypsin to prepare a cell suspension, wash the cells 3 times with serum-free medium, adjust the cells to an appropriate concentration, take 200 μL of the cell suspension and add it to the upper chamber and add 100 nM S100P human recombinant protein and different concentrations of AptS100P-1 nucleic acid respectively After aptamer treatment, 800 μL of complete medium containing 20% ​​FBS was placed in the lower chamber, and incubated in a 37°C incubator for 48h. Fixation and staining: cells were fixed with 4% paraformaldehyde for 30 minutes, stained with 0.1% crystal violet for 5 minutes, washed with PBS three times for 3 minutes, and non-penetrating cells in the upper chamber were gently wiped with ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
affinityaaaaaaaaaa
Login to View More

Abstract

The invention relates to an aptamer specifically bound with S100P protein, and screening, identification and application of the aptamer. A method comprises the following steps of designing and constructing a random oligonucleotide library, and through verification of SELEX screening and enriching, sequencing, flow type analysis, immunofluorescence, dot hybridization and the like, finally obtainingoligonucleotide which is specifically bound with S100P protein, namely the aptamer, wherein the name of the aptamer is AptS100P-1, and the sequence of the aptamer is shown as 5'-ATCCAGAGTGACGCAGCACAGGACTGC TTAGGATTGCGAAGTGCATAGAGCGGCTATATGGACACGGTGGCTTAGT-3'.

Description

technical field [0001] The present invention belongs to the fields of analytical chemistry and medical biology, and relates to a nucleic acid aptamer specifically binding to S100P and its screening, identification and application. aspect. Background technique [0002] Colorectal cancer is one of the most common malignancies worldwide. Although its treatment and prognosis have improved in the past few decades, the surgical cure rate and 5-year survival rate of colorectal cancer have always hovered around 50%. In recent years, more and more attention has been paid to the targeted therapy of colorectal cancer. The realization of tumor targeted therapy requires highly expressed targets in tumor cells. S100P protein, as a calcium-binding protein, mediates calcium-dependent signal transduction Pathway, involved in the regulation of cell cycle progression and other cell growth and differentiation processes, its expression is upregulated in a variety of cancer tissues, and it is a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/115C12N15/10
Inventor 蒋磊孙文静倪吴花
Owner THE FIRST AFFILIATED HOSPITAL OF WENZHOU MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com