Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular marker related to size of corn kernels and application of molecular marker

A molecular marker and grain size technology, applied in the field of maize breeding and molecular biology, to achieve the effect of accurate gene mapping, accelerated process, accurate and reliable results

Inactive Publication Date: 2019-06-18
UNIV OF JINAN
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on SNP molecular markers related to corn kernel size

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker related to size of corn kernels and application of molecular marker
  • Molecular marker related to size of corn kernels and application of molecular marker
  • Molecular marker related to size of corn kernels and application of molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] 1 Materials and methods

[0034] 1.1 Corn material

[0035] 1.1.1 Obtaining of mutant material skm

[0036] In 2014, at the planting base in Shunyi, Beijing, a natural mutant with a grain size of 3:1 segregation was discovered. After several generations of self-identification, it was found that the phenotype of the mutant could be inherited stably, and it was named skm.

[0037] 1.1.2 Construction of targeting groups

[0038] In May 2016, the hybrid plant pollen of the small-grain mutant was crossed with the B73 common inbred line at the planting base in Shunyi, Beijing;

[0039] In November 2016, skm was propagated in Hainan Nanfan Planting Base, and F 2 Separation groups, as targeting groups;

[0040] In May 2017, skm was propagated in the planting base in Jiyang, Shandong, and F with B73 background was constructed 3 Separate groups as fine-tuned groups.

[0041] 1.2 Statistics on the separation data of mutant skm grain traits

[0042] Take 5 B73×skm F respecti...

Embodiment 2

[0099] F 2 It is impossible to determine whether the fruit ear is homozygous (such as figure 2 ), using the SNP molecular marker Zm00001d021439 can complete the identification of the maize seed genotype at the seedling stage.

[0100] The experimental subjects were wild-type maize inbred lines B73 (10 grains), F 2 (Suspected) Homozygous ears with normal grains (10 grains), F 2 Heterozygous ears with normal grains (10 grains), F 2 Heterozygous ear mutant seeds (10 grains) were cultivated in the greenhouse to the three-leaf stage, DNA was extracted from maize leaves, diluted to 20ng / uL, mixed in equal volumes, and the B73 gene pool, suspected homozygous large-grain gene pool, and heterozygous large-grain gene pool were constructed. Gene pool, mutant seed gene pool.

[0101] The specific primers for SNP molecular markers are:

[0102] Forward primer: (CAAGTACGTGACGGCGAAC)

[0103] Reverse primer: (TTCTTCGCGACCTCTTTCTC)

[0104] Using leaf DNA of B73, suspected homozygous ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of corn breeding and molecular biology and discloses a molecular marker related to size of corn kernels and an application of the molecular marker. The molecular marker is a DNA sequence shown in SEQ No.1 on a corn skm gene, an SNP locus exists at 165bp of the DNA sequence, the basic group is G or C in the position, the basic group G corresponds to large-kernel corn while the basic group C corresponds to small-kernel corn. A traditional method for judging the size of corn kernels after corn is ripe can be replaced and effects of human factors can be completely eliminated, so that results are more accurate and reliable. The molecular marker is simpler and more effective than the traditional method, can greatly increase time benefits and economic benefits,can be applied to large-scale screening of breeding materials and can greatly accelerate the process of corn breeding study.

Description

technical field [0001] The invention belongs to the fields of corn breeding and molecular biology, in particular to a molecular marker related to the size of corn grains and its application. Background technique [0002] Corn is grown widely around the world as a source of food, animal feed and industrial materials, and is now the world's number one food crop. With rapid population growth, reduced arable land and food shortages, high yield will remain the main goal of maize breeding. Corn yield is mainly determined by the number of ears per hectare, the number of grains per ear and the average weight of each grain. Grain weight is a quantitative heritable trait controlled by many genes, and its influence is small. It is mainly determined by grain length, grain width and grain thickness. People have carried out a lot of research on the genetic basis of grain size and grain weight. [0003] Kernel weight is an important agronomic trait and yield component that can be used to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12N15/11A01H1/04
Inventor 李慧高幸幸车荣会何林林
Owner UNIV OF JINAN