Molecular marker related to size of corn kernels and application of molecular marker
A molecular marker and grain size technology, applied in the field of maize breeding and molecular biology, to achieve the effect of accurate gene mapping, accelerated process, accurate and reliable results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] 1 Materials and methods
[0034] 1.1 Corn material
[0035] 1.1.1 Obtaining of mutant material skm
[0036] In 2014, at the planting base in Shunyi, Beijing, a natural mutant with a grain size of 3:1 segregation was discovered. After several generations of self-identification, it was found that the phenotype of the mutant could be inherited stably, and it was named skm.
[0037] 1.1.2 Construction of targeting groups
[0038] In May 2016, the hybrid plant pollen of the small-grain mutant was crossed with the B73 common inbred line at the planting base in Shunyi, Beijing;
[0039] In November 2016, skm was propagated in Hainan Nanfan Planting Base, and F 2 Separation groups, as targeting groups;
[0040] In May 2017, skm was propagated in the planting base in Jiyang, Shandong, and F with B73 background was constructed 3 Separate groups as fine-tuned groups.
[0041] 1.2 Statistics on the separation data of mutant skm grain traits
[0042] Take 5 B73×skm F respecti...
Embodiment 2
[0099] F 2 It is impossible to determine whether the fruit ear is homozygous (such as figure 2 ), using the SNP molecular marker Zm00001d021439 can complete the identification of the maize seed genotype at the seedling stage.
[0100] The experimental subjects were wild-type maize inbred lines B73 (10 grains), F 2 (Suspected) Homozygous ears with normal grains (10 grains), F 2 Heterozygous ears with normal grains (10 grains), F 2 Heterozygous ear mutant seeds (10 grains) were cultivated in the greenhouse to the three-leaf stage, DNA was extracted from maize leaves, diluted to 20ng / uL, mixed in equal volumes, and the B73 gene pool, suspected homozygous large-grain gene pool, and heterozygous large-grain gene pool were constructed. Gene pool, mutant seed gene pool.
[0101] The specific primers for SNP molecular markers are:
[0102] Forward primer: (CAAGTACGTGACGGCGAAC)
[0103] Reverse primer: (TTCTTCGCGACCTCTTTCTC)
[0104] Using leaf DNA of B73, suspected homozygous ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com