Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of polypeptide with protease activity and its application

A technology of protease and fusion protein, applied in the direction of application, enzyme, peptidase, etc., can solve the problems of incomplete degradation of protein, protein inactivation, etc.

Active Publication Date: 2021-06-29
TSINGHUA UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to this specificity, caspases are able to cleave certain proteins with high selectivity at only a few (usually only 1) sites, mainly at sites between domains, Cleavage either activates or inactivates a protein, but never completely degrades a protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of polypeptide with protease activity and its application
  • A kind of polypeptide with protease activity and its application
  • A kind of polypeptide with protease activity and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] 1. Target gene cloning:

[0087] 1. Primer design: use the DrICE gene sequence as a template to design upstream and downstream primers with an NdeI restriction site at the N-terminal and an XhoI restriction site at the C-terminal.

[0088] Upstream primer (SEQ ID NO: 3): GGAATTCCATATGGCTAGAGCCCTGGGCTCCGTGGG Downstream primer (SEQ ID NO: 4): CCGCTCGAGAACCCGTCCGGCTGGTGC

[0089] 2. PCR reaction system: the total volume is 50 μL, of which, 1 μL of Ex Taq DNA polymerase (5U / μL), 5 μL of 10×PCR buffer, 1 μL of upstream and downstream primers (20 μM), 5 μL of dNTP (2.5 mM), template DNA (100ng / μL) 0.5μL, supplemented with ddH 2 0 to 50 μL.

[0090] 3. PCR amplification conditions: 94°C for 5min; 30 cycles of 94°C for 30s, 52°C for 30s, and 72°C for 90s; 72°C for 10min; store at 4°C. The PCR products were subjected to 1% agarose gel electrophoresis (100V, 30min) and the PCR amplification was detected with a gel imaging system.

[0091] 2. Double digestion reaction of PCR p...

Embodiment 2

[0115] 1. Experimental steps:

[0116] 1. Transformation of the carrier

[0117] Using the pET-15b prokaryotic expression vector as a template ( figure 2 ) was transformed, and the N-terminal linker and the DrICE restriction site total 21bp nucleotide sequence (SEQ ID NO: 5CATAGTGATGAAGTTGATGCA) was inserted between the Thrombin restriction site and the NdeI site by PCR ( image 3 ), to obtain the transformed vector pET15D ( Figure 4 ).

[0118] 2. Target gene cloning

[0119] 2.1 Primer design

[0120] Using PYL10 (SEQ ID NO: 6) as a template, the upstream and downstream primers with NdeI restriction site at the N-terminus and XhoI restriction site at the C-terminus are designed as follows:

[0121] Upstream primer (SEQ ID NO: 7): GGAATTCCATATGAATGGCGACGAAACG

[0122] Downstream primer (SEQ ID NO: 8): CCGCTCGAGCTATTCGGCTTGCAGACG

[0123] 2.2 PCR reaction system

[0124] The total volume is 50 μL, including 1 μL of Ex Taq DNA polymerase (5U / μL), 5 μL of 10×PCR buffer...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a polypeptide with protease activity and a construct, vector and host cell containing the coding nucleotide sequence of the polypeptide; more importantly, the invention discloses a kit containing the polypeptide and the protease activity Application of active polypeptide in cutting fusion protein tag. The polypeptide has high sequence specificity for enzyme cutting, and can be used as a tool enzyme specially used for specifically cutting off the tag of the recombinantly expressed protein.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a polypeptide with protease activity and its use in protein cleavage, especially fusion protein tag cleavage. Background technique [0002] Protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology, so as to facilitate the expression, detection, tracking and purification of the target protein. Fusion expression of target protein and fusion tag at the same time is one of the effective methods to improve protein solubility, increase protein expression, and facilitate separation and purification. After the fusion protein is purified, the target protein is separated from the fusion tag by protease digestion to release the target protein. Therefore, with the continuous development of protein tags, the supply of enzymes that remove protein tags is in short supply. [0003] Tobacco etch virus protease (Tob...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/64C12N15/57C12P21/06
CPCC12N9/641C12P21/06C12Y304/22062
Inventor 不公告发明人
Owner TSINGHUA UNIV