Corn ZmPIF3s mutant protein and encoding gene and application in breeding thereof

A technique for mutating genes and coding genes, which is applied to corn ZmPIF3s mutated protein and its application field, can solve the problems of reduced plant height, low selection efficiency, and no obvious negative ear effect, and achieves a wide application prospect and high efficiency. Effect

Active Publication Date: 2019-08-02
SOUTH CHINA AGRI UNIV +1
View PDF6 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] The plant height of maize is often controlled by many micro-effect quantitative trait loci (QTL). The current maize breeding still needs to reduce the plant height by continuously accumulating these micro-effect QTLs, and the selection efficiency is low.
In rice and wheat, the use of semi-dwarf genes sd1 and rht1 directly led to the first green revolution, and the yield of crops was greatly improved. However, similar green revolution genes in maize, which can effectively reduce The main semi-dwarf gene with no obvious negative effect on panicle height has not been found yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Corn ZmPIF3s mutant protein and encoding gene and application in breeding thereof
  • Corn ZmPIF3s mutant protein and encoding gene and application in breeding thereof
  • Corn ZmPIF3s mutant protein and encoding gene and application in breeding thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Construction of maize short mesocotyl and dwarf stem mutant Zmpif3s

[0048] 1. Target site design of maize ZmPIF3s gene

[0049] First obtain ZmPIF3.1 (GRMZM2G115960-T03) (its nucleotide sequence is shown in SEQ ID No.1, amino acid sequence is shown in SEQ ID No.2), ZmPIF3.2 (GRMZM2G387528-T02) from the corn Gramene database (its nucleotide sequence is shown in SEQ ID No.3, its amino acid sequence is shown in SEQ ID No.4) and ZmPIF3.3 (GRMZM2G062541-T01) (its nucleotide sequence is shown in SEQ ID No.5) , whose amino acid sequence is shown in SEQ ID No.6) genome sequence, then use Snap Gene Viewer 3.2 software to design two target sites for each ZmPIF3s gene. The target sequences are:

[0050] ZmPIF3.1-Guide 1: GTCGAGCTGCTATGGGAGAA (SEQ ID No. 7)

[0051] ZmPIF3.1-Guide 2: GGGGAAAATGGAGACCAAGA (SEQ ID No. 8)

[0052] ZmPIF3.2-Guide 1: GCAGCAGCAGAGCTCAACAA (SEQ ID No. 9)

[0053] ZmPIF3.2-Guide 2: GAAAG AAGTAGAGAC CAGGA (SEQ ID No. 10)

[0054] ZmPIF3.3-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses corn ZmPIF3s mutant protein and an encoding gene and application in breeding thereof. According to the corn ZmPIF3s mutant protein, corn ZmPIF3s protein is mutated by means ofgene editing to obtain the ZmPIF3s mutant protein with functions of reducing plant height and shortening mesocotyl length. The invention further provides a building method of a ZmPIF3s gene editing vector. The invention further discloses a breeding method for developing short-mesocotyl short-stalk corn by means of a gene editing technology. By means of the CRISPR / Cas9 gene editing technology, theZmPIF3s gene is edited, and by screening progeny, in a T2 generation, a T-DNA-removed novel material with genetically-stable characters of short mesocotyl and short stalks can be obtained. The mutantprotein and the gene editing technology can be applied for molecular breeding of plants, have the advantages of being fast, precise, efficient and the like, the breeding efficiency can be effectivelyimproved, and a breeding progress can be accelerated.

Description

technical field [0001] The invention relates to a ZmPIF3s mutant protein obtained based on gene editing technology and its coding gene. The invention further relates to their application in plant breeding, and belongs to the field of corn ZmPIF3s mutant protein and its application. Background technique [0002] The plant height of maize is often controlled by many micro-effect quantitative trait loci (QTL), and the current maize breeding still needs to reduce the plant height by continuously accumulating these micro-effect QTLs, and the selection efficiency is low. In rice and wheat, the use of semi-dwarf genes sd1 and rht1 directly led to the first green revolution, and the yield of crops was greatly improved. However, similar green revolution genes in maize, which can effectively reduce The main semi-dwarf gene with no obvious negative effect on panicle has not been found yet. [0003] Phytochrome (Phy) is an important photoreceptor in plants, which can perceive red and f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/113C12N15/82C12N15/65C07K14/415A01H5/00A01H6/46
CPCC07K14/415C12N15/113C12N15/65C12N15/8261C12N15/8213C12N2310/10C12N2310/20
Inventor王海洋吴广霞谢钰容赵永平沈荣鑫王宝宝郑智刚
OwnerSOUTH CHINA AGRI UNIV