Application of drugs that increase iron transport from the ventral hippocampus to the medial prefrontal cortex in the preparation of drugs for the treatment of neuropsychiatric diseases
A technology for neuropsychiatric diseases and ferroportin, which can be used in the field of medical biology to solve problems such as iron depletion
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1: Pharmacological / pharmacological experimental research on the brain iron transport pathway
[0041] 1. Iron chelation experiment in specific brain regions:
[0042] After anesthetized by intraperitoneal injection of 4% chloral hydrate, the mice were fixed on the mouse adapter of the stereotaxic instrument, and the eyes were kept moist with eye ointment. After cutting off the hair, disinfect the skin, cut the head skin along the midline, remove the surface connective tissue to expose the skull, adjust the position and direction of the anterior and posterior bregma, and locate according to the following coordinates.
[0043] Ventral hippocampus (AP: -3.28mm; ML: ±3.25mm; DV: -4.50mm)
[0044] Medial prefrontal cortex (AP:+1.78mm; ML:±0.3mm; DV:-2.75mm)
[0045] Substantia nigra (AP:-3.40mm; ML:±1.5mm; DV:-4.50mm)
[0046] Dorsal hippocampus (AP:-1.70mm; ML:±1.0mm; DV:-2.00mm)
[0047] Striatum (AP:+1.10mm; ML:±1.5mm; DV:-3.50mm)
[0048] Globus pallidum (AP...
Embodiment 2
[0064] Example 2: Anti-anxiety pharmacodynamic / pharmacological experimental research on enhancing iron transport from ventral hippocampus to medial prefrontal cortex
[0065] 1. Overexpression of iron transporter in the ventral hippocampus increases iron transport in the dorsal hippocampus → medial prefrontal cortex:
[0066] Firstly, retrovirus was injected in the medial prefrontal cortex to mark the neurons projecting to the upper level of the medial prefrontal cortex, and two weeks later, a virus overexpressing ferroportin was injected in the ventral hippocampus to make the neurons projecting to the medial prefrontal cortex Neurons in the ventral hippocampus overexpressed iron transporter, and iron concentrations in behavioral and brain regions were measured two weeks later.
[0067] Retrovirus: AAV2-RETRO-hSyn-cre
[0068] Titer: 2.28E+13v.g / ml
[0069] Production company: brainVTA, China
[0070] Item No.: PT-0136
[0071] Virus overexpressing ferroportin (human origi...
Embodiment 3
[0092] Example 3: Anxiolytic Pharmacological / Pharmacological Experimental Study on Reducing Iron Transport from Ventral Hippocampus → Medial Prefrontal Cortex
[0093] Similar to the method used in Example 2, the expression of ferroportin was disturbed in neurons in the ventral hippocampus projecting to the medial prefrontal cortex layer, and the overexpressed transferrin was detected by open field test, black and white box test, elevated test, etc. Behaviors such as exercise and anxiety in protein mice.
[0094] Retrovirus: AAV2-RETRO-hSyn-cre
[0095] Titer: 2.28E+13v.g / ml
[0096] Production company: brainVTA, China
[0097] Item No.: PT-0136
[0098] Interfering virus (mouse origin, interfering with the expression of ferroportin): AAV2 / 8-CMV-DIO-EGFP-FPN-shRNA
[0099] Titer: 2.15E+13v.g / ml
[0100] Production company: Obio Technology, China
[0101] Construct gene sequence: Gene ID: NM_016917.FPN shRNA: CAGACATGAATGCTACCATTA
[0102] Interference control virus: AAV...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap