Unlock instant, AI-driven research and patent intelligence for your innovation.

CasRx-based plant gene silence vector and construction method and application thereof

A technology of gene silencing and construction methods, which is applied in the directions of botanical equipment and methods, biochemical equipment and methods, and applications to achieve the effect of simple system

Pending Publication Date: 2019-09-20
WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
View PDF7 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, researchers have identified the CasRx protein that can target RNA and successfully applied it to gene silencing operations in human cell lines. By comparison, researchers found that compared with RNAi technology, the specificity and silencing efficiency of CasRx-based gene silencing technology At the same time, the system is not limited by the type of RNA, and successfully overcomes many problems in RNAi technology, but there is no report of CasRx-based gene silencing technology in plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CasRx-based plant gene silence vector and construction method and application thereof
  • CasRx-based plant gene silence vector and construction method and application thereof
  • CasRx-based plant gene silence vector and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0045] a. According to tobacco NTPDS CDS sequence, design two target sequences and corresponding primers, the end of the primer containing the core sequence contains the corresponding BsaI site, and construct a corresponding vector for each target site;

[0046] b. Construction of the gene silencing vector of the target T1: use the plasmid pHLW-CasRx as a template, and use primer pairs T1-1-F / T1-1-R and T1-2-F / T1-2-R to perform PCR, if obtained Two fragments with BsaI sites at both ends and one target sequence are recovered and purified for PCR products;

[0047] c. Take 70ng of the two products in step b and 100ng of the carrier pHLW-CasRx in step I in Example 1, use BsaI to digest for 15 minutes, and then add T4 DNA ligase to carry out cyclic digestion and ligation reaction;

[0048] d. Take 5ul of the reaction product in step c and incubate with 50ul DH5α competent cells on ice for 30 minutes, add 500ul liquid LB medium at 42°C for 30 seconds, incubate at 37°C and 200r / min ...

Embodiment 3

[0052] This example is used to illustrate the functional verification of the targeted gene silencing of tobacco genes by the CasRx-based plant gene silencing vector.

[0053] The tobacco gene NtPDS was selected as the research object, and the target sequence is shown in Table 1:

[0054] Table 1: Tobacco target gene target sequences

[0055] target number target sequence target gene T1 CCTGAAGCTCTTCCTGCGCCATTAAATGGA NTPDS T2 GGCCGGAGCCAGAAGATGTTGGCAGAAGCA NTPDS

[0056] i. According to the two designed target sequences, use the above method to construct a CasRx vector containing a single target sequence, labeled A1 (T1) and A2 (T2).

[0057] ii. Take 5 ul of the obtained vectors A1 and A2, use the standard electroporation transformation method to transform the Agrobacterium strain EHA105 competent cells, and perform screening and identification, and then pick a single colony and inoculate it in a medium containing rifampicin 50ng / ml and Kan 5...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CasRx-based plant gene silence vector and a construction method and application thereof, and relates to directed gene silencing techniques in the field of plant molecular biology. The plant gene silence vector herein is a CasRx dual-member expression vector pHLW-CasRX, structurally featuring 35S-driven CasRx protein expression and AtU6-26 promoter-driven sgRNA expression; a sequence of the plant gene silence vector is shown as SEQ ID NO. 1. The CasRx-based plant gene silence vector constructed herein is suitable for performing efficient gene silencing on plant genes quickly, simply and specifically, a CasRx-based efficient directed gene silence system of plants is supplemented, and the defects of RNAi technology are overcome; the plant gene silence system constructed herein is simple, quick and highly specific, and is suitable for performing expression knockdown and RNA interference on plant target genes quickly, efficiently and highly specifically.

Description

technical field [0001] The present invention relates to the directional gene silencing technology in the field of plant molecular biology, in particular to a plant gene silencing vector based on CasRx (ribonuclease effector of Xanthococcus xanthococcus XPD3002) and its construction method and application. Background technique [0002] Gene silencing refers to the phenomenon of non-expression or low-level expression of genes without changing the genomic DNA sequence; in the actual operation of gene silencing technology, people often use the gene silencing mechanism at the post-transcriptional level (RNAi technology); RNAi technology It has been successfully used in the analysis of plant gene functions, plant resistance to pests and diseases, and quality improvement. However, RNAi technology has disadvantages such as inconsistent inhibition efficiency, obvious off-target effects, unexpected effects and adverse effects on non-target organisms. Therefore, the development of a A ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82A01H5/00A01H6/82
CPCC12N15/8218C12N15/8205
Inventor 汪祖鹏钟彩虹
Owner WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More