CasRx-based plant gene silence vector and construction method and application thereof
A technology of gene silencing and construction methods, which is applied in the directions of botanical equipment and methods, biochemical equipment and methods, and applications to achieve the effect of simple system
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 2
[0045] a. According to tobacco NTPDS CDS sequence, design two target sequences and corresponding primers, the end of the primer containing the core sequence contains the corresponding BsaI site, and construct a corresponding vector for each target site;
[0046] b. Construction of the gene silencing vector of the target T1: use the plasmid pHLW-CasRx as a template, and use primer pairs T1-1-F / T1-1-R and T1-2-F / T1-2-R to perform PCR, if obtained Two fragments with BsaI sites at both ends and one target sequence are recovered and purified for PCR products;
[0047] c. Take 70ng of the two products in step b and 100ng of the carrier pHLW-CasRx in step I in Example 1, use BsaI to digest for 15 minutes, and then add T4 DNA ligase to carry out cyclic digestion and ligation reaction;
[0048] d. Take 5ul of the reaction product in step c and incubate with 50ul DH5α competent cells on ice for 30 minutes, add 500ul liquid LB medium at 42°C for 30 seconds, incubate at 37°C and 200r / min ...
Embodiment 3
[0052] This example is used to illustrate the functional verification of the targeted gene silencing of tobacco genes by the CasRx-based plant gene silencing vector.
[0053] The tobacco gene NtPDS was selected as the research object, and the target sequence is shown in Table 1:
[0054] Table 1: Tobacco target gene target sequences
[0055] target number target sequence target gene T1 CCTGAAGCTCTTCCTGCGCCATTAAATGGA NTPDS T2 GGCCGGAGCCAGAAGATGTTGGCAGAAGCA NTPDS
[0056] i. According to the two designed target sequences, use the above method to construct a CasRx vector containing a single target sequence, labeled A1 (T1) and A2 (T2).
[0057] ii. Take 5 ul of the obtained vectors A1 and A2, use the standard electroporation transformation method to transform the Agrobacterium strain EHA105 competent cells, and perform screening and identification, and then pick a single colony and inoculate it in a medium containing rifampicin 50ng / ml and Kan 5...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com