Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for rapid construction of RNA 3' terminal gene expression library

A gene expression and library technology, applied in the field of molecular biology, can solve the problems that the end of the molecule cannot be introduced by a transposase, the sequence may be the same or different, and the two ends of the 3' region of the mRNA molecule cannot be connected by different adapters, so as to avoid information Lost, the method is simple and easy to implement, and the effect of building a library is high

Inactive Publication Date: 2019-09-20
BEIJING TRANSGEN BIOTECH CO LTD
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] As a relatively new DNA library construction technology, the two characteristics of the transposase complex include: 1. Randomly introduce the first or second linker at both ends of the DNA fragment. For a single fragment, the sequences at both ends may be the same or May be different; 2. The molecular ends of the DNA template cannot be introduced into the adapter by the transposase
These two points are not a problem for DNA library construction using the genome as a template, but for RNA library construction, it is impossible to connect different adapters at the 3' region of the mRNA molecule in a directional manner

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapid construction of RNA 3' terminal gene expression library
  • Method for rapid construction of RNA 3' terminal gene expression library
  • Method for rapid construction of RNA 3' terminal gene expression library

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Example 1 Entering the double-end sequencing adapter by means of PCR after the transposition method

[0080] 1. Enrichment of mRNA

[0081] For the enrichment of eukaryotic mRNA, the specific steps are conventional mRNA enrichment steps, for example, the mRNA purification kit (Beijing Quanshijin Biology, catalog number: EC801) can be used, and the steps are omitted here.

[0082] 2. Synthesis of first-strand cDNA

[0083] Synthesis of the first-strand cDNA, for example, using the first-strand cDNA transcription synthesis kit (Beijing Quanshijin Biology, catalog number: AT301):

[0084] 1> Add each component according to the following system:

[0085]

[0086] Oligo(T)-VN1 is an Oligo(dT) reverse transcription primer with a first linker, the sequence is: GACGTGTGCTCTTCCGATCTAAAAAAAAAAAAAAAAAAAAAAAAVN (as shown in SEQ ID NO.1), wherein V represents G / A / C among the three bases Any one of the bases, N represents any one of the four bases G / A / C / T.

[0087] 2> Mix gently...

Embodiment 2

[0118] Direct sequencing after embodiment 2 transposition method

[0119] 1. Enrichment of mRNA

[0120] With step 1 in embodiment 1

[0121] 2. Synthesis of first-strand cDNA

[0122] Synthesis of first-strand cDNA was performed. For example, in this example, the first-strand cDNA transcription synthesis kit (Beijing Quanshijin Biology, catalog number: AT301) was used to perform this operation:

[0123] 1> Add each component according to the following system:

[0124]

[0125] Oligo(T)-VN2 is Oligo(dT) reverse transcription primer 2 with a first linker, its sequence is: CAAGCAGAAGACGGCATACGAGAT[index-i5]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAAAAAAAAAAAAAAAAAAAAAAAAVN.

[0126] Among them, [index-i5] plays the role of distinguishing the data of each sample, each sample has a different index, and the data of the sample will be distinguished by the difference of the index during sequencing; [index-i5] is inserted into the The original sequence 2 of the Oligo (dT) reverse tra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for rapid construction of a RNA 3' terminal gene expression library. The method includes: subjecting an mRNA sample to reverse transcription by adopting an Oligo (dT) reverse transcription primer with a first joint to obtain a first chain cDNA with the first joint; synthesizing a second chain cDNA by taking the first chain cDNA as a template to obtain a double-stranded cDNA with the first joint; processing the double-stranded cDNA by adopting a transposase compound with a second joint, and inserting the second joint during fragmentation to obtain a double-stranded cDNA fragment with the first joint and / or the second joint, wherein sequences of the first joint and the second joint are not the same. By adoption of the method, construction of a transcriptome library aiming at eukaryotic RNA 3' terminals can be realized effectively.

Description

technical field [0001] The invention relates to the technical field of molecular biology. More specifically, it relates to a method for rapidly constructing an RNA 3' end gene expression library. Background technique [0002] With the advent of the post-genome era, gene expression and transcriptomics research, as a powerful tool, occupies an increasingly important position in today's life science research. It can help people gain an in-depth understanding of gene structure, reveal gene expression under specific conditions, and the regulation mechanism of organisms in response to changes in the external environment. Different from the research at the DNA level, the construction and detection of mRNA expression libraries can more accurately and directly reflect the expression differences at the level of individual organisms, tissues, and even single cells; as an upstream research category of proteomics, gene expression detection is the basic Research and precision medicine, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6806C12N15/10C40B50/06
CPCC12N15/1096C12Q1/6806C40B50/06C12Q2521/107C12Q2525/191C12Q2531/113C12Q2535/122
Inventor 耿亮辛文
Owner BEIJING TRANSGEN BIOTECH CO LTD