Gene NtAOS1 for improving jasmonic acid content in tobacco leaves, cloning method and application of NtAOS1
A cloning method, the technology of jasmonic acid, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1——Isolation and cloning of NtAOS1 gene, comprising the following steps:
[0032] A. NtAOS1 gene sequence verification;
[0033] The NtAOS1 gene was cloned using the following primers:
[0034] Forward primer: NtAOS1_F: ATGGCAGTAGCAACAGCAACAG
[0035] Reverse primer: NtAOS1_R: TCAAATTTCCGTTCCAACTCCGATC
[0036] B. extract tobacco leaf tissue RNA, and reverse transcribe to obtain the first-strand cDNA;
[0037] C. Using the first-strand cDNA obtained by reverse transcription as a template, perform PCR amplification with primers NtAOS1F / NtAOS1R, recover and purify the PCR product;
[0038] D. The purified product is connected to the carrier. The connection system and process are as follows:
[0039] Connection system: 10μL
[0040]Mix 4 μL of purified product, 1 μL of PCR-BluntⅡ-TOPO (Invitrogen), 2 μL of 5X buffer, 1 μL of T4 ligase, H 2 O 2 μL.
[0041] Reaction steps:
[0042] The purified product was reacted at 25°C for 10 minutes,
[0043] The vec...
Embodiment 2
[0045] A. RNAi vector construction:
[0046] Using the positive clone after verification of the NtAOS1 gene as a template, PCR amplification was carried out with primers containing the Gateway linker sequence. After the PCR product was purified, the amplified product was inserted into the pDONR Zeo vector of Invitrogen Company through BP reaction. The constructed BP reaction vector was used to replace the NtAOS1-RNAi fragment into the pHELLSGATE 12 interference expression vector by LR reaction. Specific steps are as follows:
[0047] (1) Design primers according to the tobacco gene NtAOS1 gene sequence:
[0048] RNAi-F: 5'-GCTGGAAAGGATTTTGTGGTGC-3'
[0049] RNAi-R: 5'-TCAAATTTCCGTTCCAACTCCGATC-3'
[0050] According to the requirements of the BP reaction in the Gateway system, a 5'-GGGACAAGTTTGTACAAAAAGCAGGCTGC-3' sequence was added before the forward primer, and a 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTC-3' sequence was added before the reverse primer. Get the Gateway reaction pr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



