Check patentability & draft patents in minutes with Patsnap Eureka AI!

Gene NtAOS1 for improving jasmonic acid content in tobacco leaves, cloning method and application of NtAOS1

A cloning method, the technology of jasmonic acid, applied in the field of genetic engineering

Active Publication Date: 2019-10-08
YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF28 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It has also been reported that the development-related JAs synthesis and the wound-induced JAs synthesis in Arabidopsis are overlapping, but not identical, that is, there may be two JA synthesis pathways or two different synthetic regulatory pathways in plants, This has brought great difficulty to the study of JA synthesis pathway, but it also indicates that there are more ways to regulate the synthesis pathway

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene NtAOS1 for improving jasmonic acid content in tobacco leaves, cloning method and application of NtAOS1
  • Gene NtAOS1 for improving jasmonic acid content in tobacco leaves, cloning method and application of NtAOS1
  • Gene NtAOS1 for improving jasmonic acid content in tobacco leaves, cloning method and application of NtAOS1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1——Isolation and cloning of NtAOS1 gene, comprising the following steps:

[0032] A. NtAOS1 gene sequence verification;

[0033] The NtAOS1 gene was cloned using the following primers:

[0034] Forward primer: NtAOS1_F: ATGGCAGTAGCAACAGCAACAG

[0035] Reverse primer: NtAOS1_R: TCAAATTTCCGTTCCAACTCCGATC

[0036] B. extract tobacco leaf tissue RNA, and reverse transcribe to obtain the first-strand cDNA;

[0037] C. Using the first-strand cDNA obtained by reverse transcription as a template, perform PCR amplification with primers NtAOS1F / NtAOS1R, recover and purify the PCR product;

[0038] D. The purified product is connected to the carrier. The connection system and process are as follows:

[0039] Connection system: 10μL

[0040]Mix 4 μL of purified product, 1 μL of PCR-BluntⅡ-TOPO (Invitrogen), 2 μL of 5X buffer, 1 μL of T4 ligase, H 2 O 2 μL.

[0041] Reaction steps:

[0042] The purified product was reacted at 25°C for 10 minutes,

[0043] The vec...

Embodiment 2

[0045] A. RNAi vector construction:

[0046] Using the positive clone after verification of the NtAOS1 gene as a template, PCR amplification was carried out with primers containing the Gateway linker sequence. After the PCR product was purified, the amplified product was inserted into the pDONR Zeo vector of Invitrogen Company through BP reaction. The constructed BP reaction vector was used to replace the NtAOS1-RNAi fragment into the pHELLSGATE 12 interference expression vector by LR reaction. Specific steps are as follows:

[0047] (1) Design primers according to the tobacco gene NtAOS1 gene sequence:

[0048] RNAi-F: 5'-GCTGGAAAGGATTTTGTGGTGC-3'

[0049] RNAi-R: 5'-TCAAATTTCCGTTCCAACTCCGATC-3'

[0050] According to the requirements of the BP reaction in the Gateway system, a 5'-GGGACAAGTTTGTACAAAAAGCAGGCTGC-3' sequence was added before the forward primer, and a 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTC-3' sequence was added before the reverse primer. Get the Gateway reaction pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene NtAOS1 for improving jasmonic acid content in tobacco leaves, a cloning method and an application of the NtAOS1. The nucleotide sequence of the NtAOS1 which can improvethe content of jasmonic acid in tobacco is shown in SEQ ID NO. 1; the amino acid sequence encoding the protein is shown in SEQ ID NO. 2; a nucleic acid interference (RNAi) technology is used to designa segment of interference fragment, a gateway technology is used to construct plant expression vector and transform tobacco, and a qPCR technology is used to select NtAOS1 gene transcription level to significantly reduce transgenic plants. Detection of jasmonic acid content shows that the decreased expression level of the gene NtAOS1 results in significantly higher jasmonic acid content than that of wild-type control. The invention provides a material basis for applying the gene NtAOS1 and coded protein thereof to tobacco stress resistance breeding and subsequent research on jasmonic acid synthesis and metabolism pathway in tobacco.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a gene NtAOS1 for increasing the content of jasmonic acid in tobacco leaves, a cloning method and application thereof. Background technique [0002] Jasmonic acid (JA) and its methyl ester derivative methyljasmonate (MeJA) are important plant growth regulators, which play a regulatory role in the process of plant growth. On the one hand, jasmonic acid can regulate the growth and development of plants, such as the germination and growth of seeds, the growth and development of organs, and the aging and apoptosis of plants. On the other hand, jasmonic acid also participates in the defense response of plants to biotic and abiotic stress. The biosynthetic pathway of JA is also known as the octadecane-like biosynthetic pathway: 13(S)-hydroperoxylinolenic (13-HPOT) is synthesized from linolenic acid catalyzed by lipoxygenase (LOX), 13 -HPOT generates 10,11-dihyd...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/61C12N9/90C12N15/10A01H5/12A01H6/82
CPCC12N9/90C12N15/8243C12Y503/99006
Inventor 姚恒谢贺白戈杨大海童治军方敦煌曾建敏陈学军张谊寒肖炳光李永平
Owner YUNNAN ACAD OF TOBACCO AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More