Nucleic acid aptamer and its circular bivalent nucleic acid aptamer-drug coupling system and application thereof

A nucleic acid aptamer, nucleic acid aptamer technology, applied in the field of biomedicine, can solve the problem of less nucleic acid aptamer, and achieve the effects of strong affinity, good affinity, and reduced damage

Active Publication Date: 2019-10-22
HUNAN UNIV
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, some nucleic acid aptamers of malignant tumor cells have been reported successively, but there are few types of nucleic acid aptamers at present, and before they are conjugated with anticancer drugs, specific bases need to be chemically modified, which can be used in chemical There are relatively few types of modified groups at present, so the development of new nucleic acid aptamers to achieve precise and targeted release of cancer drugs is of great significance to the combination therapy of malignant tumor drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer and its circular bivalent nucleic acid aptamer-drug coupling system and application thereof
  • Nucleic acid aptamer and its circular bivalent nucleic acid aptamer-drug coupling system and application thereof
  • Nucleic acid aptamer and its circular bivalent nucleic acid aptamer-drug coupling system and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] The preparation of embodiment 1 azide-drug

[0034] The synthetic route of described azide-drug, such as figure 1 Shown, specifically include the synthesis of the following azide-drugs.

[0035] Synthesis of azide-camptothecin

[0036] Camptothecin (64mg, 0.18mmol), azide-PEG 3 -Carboxyl (86mg, 0.37mmol), N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC·HCl, 71mg, 0.37mmol) and 4-dimethyl A solution of a mixture of aminopyridines (DMAP, 45 mg, 0.37 mmol) in DCM (10 mL) at room temperature under N 2 Stir overnight. The reaction mixture was then concentrated in vacuo and the product was purified by flash chromatography to give a yellow solid yielding azide-camptothecin (CPT).

[0037] Synthesis of Azide-paclitaxel

[0038] Paclitaxel (86mg), azide-PEG 3 -Carboxyl (25mg), a mixture of N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC·HCl, 38mg) and 4-dimethylaminopyridine (DMAP , 24 mg, 0.37 mmol) in DCM (10 mL) at room temperature un...

Embodiment 2

[0043] The modification of embodiment 2 nucleic acid aptamers

[0044] The nucleic acid sequence of the aptamer shown in SEQ ID NO: 2 is modified by a phase synthesizer with a dibenzocyclooctyne functional group (DBCO), and the modified sequence XQ-2d-1 is as follows: TGACTGATTTACGGCTCATAG GGT( DBCO) TAGGGGCTGCTGGCCAGA TAC TCA GATGGTAGG GTTACTATGAGC.

[0045] The nucleic acid sequence of the aptamer shown in SEQ ID NO: 3 is modified by a phase synthesizer with two dibenzocyclooctyne functional groups (DBCO), and the modified sequence XQ-2d-2 is as follows: CGTAAATCAGTCAGCATAGGGT (DBCO )TAGGGGCTGCT(DBCO)GGCCAGATACTCAGATGGTAGGGTT ACTATGAGC

[0046] The nucleic acid sequence of the aptamer shown in SEQ ID NO: 2 is modified by a phase synthesizer with three dibenzocyclooctyne functional groups (DBCO), and the modified sequence XQ-2d-3 is as follows: TGACTGATTT (DBCO )ACGGCTCATAGGGT(DBCO)TAGGGGCTGCT(DBCO)GGCCAGATACTCAGATGGTAGGGTTACTATGAGC.

Embodiment 4

[0047] Example 4 Preparation of Nucleic Aptamer-Drug Conjugate Monomer (ApDC)

[0048] Preparation of XQ-2d-CPT: the following reaction system was prepared in Duchenne's phosphate buffer: nucleic acid aptamer XQ-2d-1 (Example 2) 1OD, azide-camptothecin (Example 1) 1mM, two The volume percentage of methyl sulfoxide is 10%. The above reaction system was placed at 37°C and reacted for 8h. The product was purified by HPLC and then lyophilized and concentrated to obtain the monomer XQ-2d-CPT. The resulting solution was stored at -20°C until use.

[0049] Preparation of XQ-2d-2CPT: The preparation method is the same as XQ-2d-CPT, only XQ-2d-1 is replaced by XQ-2d-2.

[0050] Preparation of XQ-2d-3CPT: The preparation method is the same as that of XQ-2d-CPT, only XQ-2d-1 is replaced by XQ-2d-3.

[0051] Preparation of XQ-2d-PTX: The preparation method is the same as that of XQ-2d-CPT, except that azide-camptothecin is replaced by azide-paclitaxel.

[0052] Preparation of XQ-2d-2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a nucleic acid aptamer and its circular bivalent nucleic acid aptamer-drug coupling system and an application thereof. The system comprises a nucleotide sequence of X-GCTCATAGGGTTAGGGGCTGCTGGCCAGATACTCAGATGGTAGGGTTACTATGAGC, wherein: X is absent (SEQ ID NO: 1), or is one of the TGACTGATTTACG (SEQ ID NO: 2) and CGTAAATCAGTCA (SEQ ID NO: 3) sequences. The nucleic acidaptamer of the invention has good affinity for various cancer cells, and after modification, the nucleic acid aptamer can be combined with various anticancer drugs to make the drug targeted, and theutilization rate of the drug is increased, a monomer linked to the drug after modification can also be prepared into the nucleic acid aptamer-drug coupling system, which is loaded with a plurality ofdrugs, and synergistic effect of drugs is achieved. The drug effect is improved, the circular divalent nucleic acid aptamer-drug coupling system is simple and efficient in synthesis, and does not require complicated reactions, and provides a new method for multi-drug combination therapy.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a nucleic acid aptamer and a circular bivalent nucleic acid aptamer-drug coupling system and application thereof. Background technique [0002] Chemotherapy is still the main method of malignant tumor treatment. However, the occurrence, development, invasion, and metastasis of malignant tumors are related to changes in various signaling pathways. Due to pathway redundancy, when one signaling pathway is blocked, tumor cells can still grow through other pathways or turn on an alternative pathway. Therefore, monotherapy targeting a single signaling pathway in malignant tumor cells has limited effects and easily induces drug resistance in tumor cells. Compared with single drug therapy, drug combination therapy targeting multiple signaling pathways related to the development of tumor cells can effectively reduce the dose of a single drug, improve the therapeutic effe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K47/54A61K45/00C12N15/115A61P35/00
CPCA61K45/00A61K47/549A61P35/00C12N15/115
Inventor赵子龙周芳王鹏张朋歌谭蔚泓
OwnerHUNAN UNIV