Unlock instant, AI-driven research and patent intelligence for your innovation.

SNP molecular marker related to shade of colors of green-eggshell egg shell of chicken and application of SNP molecular marker

A technology of molecular markers and eggshells, which is applied in the direction of recombinant DNA technology, measurement/testing of microorganisms, DNA/RNA fragments, etc., can solve the problems of slow genetic progress, high cost, long generation interval, etc., to improve genetic progress and reduce Feeding cost and the effect of improving production efficiency

Active Publication Date: 2019-11-19
JIANGSU INST OF POULTRY SCI
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no effective breeding method for the depth of the eggshell color of green-egg eggs at present, and artificial breeding is still mostly used. Slow, long generation interval, high cost, and inconsistent selection criteria of different breeders, thus affecting the accuracy of selection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP molecular marker related to shade of colors of green-eggshell egg shell of chicken and application of SNP molecular marker
  • SNP molecular marker related to shade of colors of green-eggshell egg shell of chicken and application of SNP molecular marker
  • SNP molecular marker related to shade of colors of green-eggshell egg shell of chicken and application of SNP molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Genome-wide association analysis

[0039] (1) Collect the venous blood of F2 generation chicken wings, and use the standard phenol-chloroform method to extract genomic DNA. DNA quality detection, concentration determination, etc. were carried out through standard procedures, and finally the OD 260 / 280 ratio between 1.8-2.0 was selected as qualified for subsequent tests. The concentration was uniformly diluted to 50ng / ul for genotyping.

[0040] (2) Use Affymetrix's chicken 600K high-density gene chip for genotyping, and refer to the chip manual for genotyping and quality control, mainly including: using APT v1.16.0 for quality control before typing; PLINK v1.90 for genotyping Quality control, reject call rate less than 0.97, deviation from Hardy-Weinberg balance ≤10 -6 SNP markers; BEAGLE v4.0 selects R2 SNPs >0.5 were filled. Quality control left 435867 SNPs and 1075 samples for subsequent analysis.

[0041] (3) Genome-wide association study (GWAS) method...

Embodiment 2

[0044] Example 2 Establishment of detection method for eggshell color alleles of green-shelled eggs

[0045] (1) Amplify a 237bp nucleotide fragment in the PIK3C2G gene of the target fragment primer of the SNP marker site significantly related to the eggshell color of green-egg eggs, and the upstream and downstream primers for sequence amplification are:

[0046] Upstream primer green-F: CTGATTTCTCTGGCTCCTGG (SEQ ID NO.1)

[0047] Downstream primer green-R: TGCTTCTGGAGATTGCTGTG (SEQ ID NO.2)

[0048] (2) PCR amplification:

[0049] The reagents in this example were obtained from Nanjing Novizan Company, and the primer synthesis and sequencing were completed by Shanghai Sangong Company.

[0050] The genomic DNA of the L3 strain after three generations of selection and breeding of green-egg-producing individuals produced by crossing Dongxiang green-shell hens and Bai Laihang hens was used as a template, and PCR amplification was performed using primers green-F and green-R.

...

Embodiment 3

[0061] Example 3 Effect Analysis of Molecular Marker SNP rs312347405 C>G Mutation

[0062] A SNP molecular marker for improving the eggshell color of green-egg eggs provided by the present invention has an effect on the a value and b value of 32 weeks of age of 14.98% and 38.14% respectively, and the effect values ​​on the eggshell color of other periods are also all within 5%. %above. Using the SNP markers to carry out molecular markers for assisted selection can significantly deepen the eggshell color of the green-egg eggs, and accelerate the eggshell color breeding process of the green-egg eggs.

[0063] Table 1 Analysis of the effect of SNP markers on the eggshell color of green-shelled eggs at different ages

[0064] %

[0065]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP molecular marker related to shade of colors of green-eggshell egg shell of a chicken, and belongs to the technical field of molecular markers. An SNP locus of the SNP molecular marker is located at the position 64135653 on a chromosome 1 of the Primary Assembly version of an international chicken reference genome GRCg6a, that is, the base position 238898 of a gene PIK3C2G, and the base at the position is C or G. The invention further provides a primer combination for detecting the SNP marker and application of the primer combination. By using the SNP molecular marker and the primer combination, an efficient and accurate molecular marker assisted breeding technology of the green-eggshell egg shell color of the chickens can be established, so that a breeding method of green-eggshell egg shell color of the chickens is effectively improved, and the development of local characteristic laying hen industry is promoted.

Description

technical field [0001] The invention belongs to the technical field of molecular markers, and in particular relates to a SNP molecular marker related to the eggshell color depth of chicken green-shelled eggs and an application thereof. Background technique [0002] There are abundant genetic resources of native chickens in my country. Green-shell egg-producing chickens include Dongxiang green-shell hens, Changshun green-shell hens, etc. The color of green-shell eggs is a quality trait, which is affected by the insertion of an EAV-HP sequence upstream of the gene SLCO1B3. , is a dominant gene. When the genotype is OO or Oo, the eggshell color is green. In production, the purebred green shell is often selected by genetic detection of homozygous genes. [0003] With the improvement of people's living standards, the market share of local characteristic laying hens is increasing, and the development of green-shell laying hens as a local characteristic laying hens in our country is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 王克华曲亮郭军沈曼曼马猛王星果胡玉萍卢建窦套存李永峰李尚民
Owner JIANGSU INST OF POULTRY SCI