RNA site-directed editing technology based on CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas13a

An editing and technical technology, applied in the field of RNA fixed-point editing, can solve the problems of easy off-target and low binding force

An editing and technical technology, applied in the field of RNA fixed-point editing, can solve the problems of easy off-target and low binding force

CN110527697AActive Publication Date: 2019-12-03CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RNA site-directed editing technology based on CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas13a
  • RNA site-directed editing technology based on CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas13a
  • RNA site-directed editing technology based on CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas13a

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1. The Crispr-Cas13a-based RNA site-directed editing technology is used to restore the mutated green fluorescent protein gene transcript

[0069]1. Expression of dCas13a-hADAR2d fusion protein in fission yeast cells

[0070] 1. Construction of pDUAL-HFF1-dCas13a-hADAR2d vector expressing dCas13a-hADAR2d fusion protein

[0071] In the following examples, the Cas13a variant is called "dCas13a", which corresponds to the mutation at position 1278 of its amino acid sequence.

[0072] The gene of dCas13a-hADAR2d fusion protein (dCas13a coding sequence is located at the 5' end) was synthesized by gene synthesis method (Jin Weizhi). The gene sequence includes the yeast linker sequence (underlined part), and the sequence is as follows (SEQ ID NO: 1):

[0073]

[0074]

[0075] In the above sequence, the bases in the box are the bases of the mutant sites, and the underlines are the linker sequences. Among them, the 1-1389th position is the dCas13a sequence, and th...

Embodiment 2

[0127] Example 2, RNA site-directed editing technology based on Crispr-Cas13a is used for fission yeast endogenous gene tdh1 transcript

[0128] 1. Expression of dCas13a-hADAR2d fusion protein in fission yeast cells

[0129] Using the same method as in Example 1, the dCas13a-hADAR2d fusion protein was expressed in fission yeast cells.

[0130] 2. Expression of CRISPR-Cas13a crRNA targeting tdh1 gene transcript in fission yeast cells

[0131] 1. Design primers targeting the crRNA of the tdh1 gene, the sequence is as follows (capital letters indicate crRNA):

[0132] tdh1-crRNA-P5:aacGAATTGCCATTTTGAATCAAGTGTAAATCAATACCATGGATGAATGATCTATACAGAAGCGATGC (SEQ ID NO: 13);

[0133] tdh1-crRNA-P3:gccGCATCGCTTCTGTATAGATCATTCATCCATGGTATTGATTTACACTTGATTCAAAATGGCAATTC (SEQ ID NO: 14);

[0134] 2. Construct the plasmid pSK-crRNA(tdh1), the specific operation method is as follows:

[0135] A. Dissolve tdh1-crRNA-P5 and tdh1-crRNA-P3 primers into 10 μM stock solution with water, take 10 μL ...

Embodiment 3

[0152] Example 3. The RNA site-directed editing technology based on Crispr-Cas13a is used to restore the transposition function of the fission yeast retrotransposon

[0153] 1. Expression of dCas13a-hADAR2d fusion protein in fission yeast cells

[0154] Using the same method as in Example 1, the dCas13a-hADAR2d fusion protein was expressed in fission yeast cells.

[0155] 2. Expression of mutant retrotransposon TF1(G1165A) in fission yeast cells

[0156] 1. The Tf1(G1165A) gene was amplified by Over-lap PCR method

[0157] A. Amplify the 5' fragment of Tf1(G1165A) gene

[0158] With pHL414 (Professor Henry L.Levin's lab) as template, with TF1-XhoI-nmt1-P5 (ATCATCATATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGT (SEQ ID NO: 19)) and Tf1-1165-mutant-P3 (TCAGGGTGGTCACGAGGGTGGGCTAGGGCACGGGCAGC TT0GCCGT) IDGCCG ) as primers for PCR amplification to obtain the 5' fragment of Tf1(G1165A) gene.

[0159]B. Using pHL414 as a template, Tf1-1165-mutant-P5 (ACCGGCAAGCTGCCCGTGCCCTAGCCCACCCTCGTGACCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a site-directed RNA (Ribonucleic Acid) editing technology based on CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas13a, and discloses an RNA site-directed editing method based on the CRISPR-Cas13a. By use of the method disclosed by the invention, during RNA site-directed editing, under the guidance of a crRNA, a Cas13a mutant takes a catalytic structural domain of ADAR2 (Adenosine Deaminase Acting on RNA 2) to an appointed RNA position to finish the site-directed editing from A to I. The Cas13a mutant does not have ssRNA cleavage activity, has ssRNA binding activity and is blended with the catalytic structural domain of the ADAR2. On the basis, the design of the crRNA is also optimized.

Description

technical field [0001] The invention belongs to the technical field of gene modification, and more specifically, the invention relates to a CRISPR-Cas13a-based RNA fixed-point editing technology. Background technique [0002] For most organisms, genetic information is transmitted from DNA to RNA, and then from RNA to protein, so as to complete the control of individual phenotype by genetic information. The regulation of biological individuals can start from three levels: DNA regulation, RNA regulation and protein regulation. A variety of different techniques and operational tools have been developed for regulation at the two levels of DNA and RNA. The manipulation techniques for DNA include: 1) The Red / ET DNA recombination technique developed based on the Red protein and Rac protein of the bacteriophage and which can be operated in the RecBCD- strain. 2) Rely on DNA recombination technology mediated by homing endonuclease (meganuclease). 3) DNA editing technology based on...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
03 Dec 2019
Publication
CN110527697A
IPC
C12N15/90; C12N15/62; C12N9/22; C12N9/78; C12N15/63
CPC
C12N15/902; C12N9/22; C12N9/78; C12Y305/04002; Y02A50/30
Inventors
李轩; 荆新云