Unlock instant, AI-driven research and patent intelligence for your innovation.

Replication-deficient type recombinant human type 7 adenovirus, preparation method and application thereof

A replication-deficient, adenovirus technology, applied to biochemical equipment and methods, viruses, viral peptides, etc., can solve problems such as restricting use, reducing immune responses of T and B cells, and achieve good production capacity

Inactive Publication Date: 2019-12-27
GUANGZHOU N BIOMED LTD
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The presence of pre-existing antibodies can reduce the T and B cell immune responses induced by adenovirus vector vaccines, which greatly limits the use of these vectors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Replication-deficient type recombinant human type 7 adenovirus, preparation method and application thereof
  • Replication-deficient type recombinant human type 7 adenovirus, preparation method and application thereof
  • Replication-deficient type recombinant human type 7 adenovirus, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1: Circularization of the Ad7 genome.

[0052] 1. Construction of the shuttle plasmid pT-Ad7(L+R) for circularizing the Ad7 genome.

[0053] Using the Ad7 genome as a template, the left arm (L-Ad7) and the right arm (R-Ad7) of the Ad7 genome were obtained by PCR.

[0054] L-Ad7 primer:

[0055] L-Ad7-F: ACTGCGATCGCCTCTCTATTTAATATACCTTATAGATGG

[0056] L-Ad7-R: ACATGGATCCTCACTGAAGATAATCTCCTGTGG

[0057] PCR conditions: 95°C, 3min; 95°C, 30s; 56°C, 30s; 72°C, 40s; cycles30; 72°C, 5min;

[0058] R-Ad7 primer:

[0059] R-Ad7-F: AGCTGGATCCGAACCACCAGTAATATCATCAAAG

[0060] R-Ad7-R: TGAGCGATCGCCTCTCTATAATAATACCTTATAGATGGAA

[0061] PCR conditions: 95°C, 3min; 95°C, 30s; 56°C, 30s; 72°C, 1min; cycles30; 72°C, 5min;

[0062] The PCR product and the T vector were ligated with three fragments using Exnase recombinase to obtain pT-Ad7(L+R).

[0063] 2. Construction of pAd7.

[0064] pT-Ad7(L+R) was digested and linearized with BamHI, and then co-transformed with th...

Embodiment 2

[0065] Example 2: Knockout of E3 gene and construction of pAd7ΔE3 plasmid.

[0066] 1. Construction of the E3 gene knockout shuttle plasmid pVax-ΔE3(L+R).

[0067] Construction of E3 gene knockout shuttle plasmid pVax-ΔE3(L+R). Using the genome of Ad7 as a template, the left arm (L-ΔE3) and right arm (R-ΔE3) of the E3 gene were obtained by PCR.

[0068] L-ΔE3 primer:

[0069] L-ΔE3-F: CATACTAGTCTGTCTACTTCAACCCCTTCTCCG

[0070] L-ΔE3-R:GCAGAATTCATTTAAATGGAGGAAGGGTCTGGGTCTTCTG

[0071] PCR conditions: 95°C, 3min; 95°C, 30s; 63°C, 30s; 72°C, 30s; cycles30; 72°C, 5min;

[0072] R-ΔE3 primer:

[0073] R-ΔE3-F:GCAGATATCATTTAAATAGACCCTATGCGGCCTAAGAGAC

[0074] R-ΔE3-R: ACATCTAGAGACAGTTGGCTCTGGTGGGGT

[0075] PCR conditions: 95°C, 3min; 95°C, 30s; 61°C, 30s; 72°C, 40s; cycles30; 72°C, 5min;

[0076] After L-ΔE3 was digested with SpeI+EcoRI, it was connected to the pVax vector digested with the same enzyme to obtain pVax-L-ΔE3. R-ΔE3 was digested with EcoRV+XbaI, and connected...

Embodiment 3

[0079] Example 3: Knockout of E1 gene and construction of pAd7ΔE1ΔE3 plasmid.

[0080] 1. Construction of the E1 gene knockout shuttle plasmid pT-Ad7ΔE1(L+R).

[0081] Construction of E1 gene knockout shuttle plasmid pT-Ad7ΔE1(L+R). Using the genome of Ad7 as a template, the left arm (L-ΔE1) and the right arm (R-ΔE1) of the E1 gene were obtained by PCR.

[0082] L-ΔE1 primer:

[0083] L-ΔE1-F: ACTCACCGGCGGCGATCGCCTCTCTATTTAATATACCTTATAGATGG

[0084] L-ΔE1-R: ATCACAATTGAATTCGTTTAAACGTAATCGAAACCTCCACGTAA

[0085] PCR conditions: 95°C, 3min; 95°C, 30s; 54°C, 30s; 72°C, 30s; cycles30; 72°C, 5min;

[0086] R-SE1 primer:

[0087] R-SE1-F: ATAGAATTCACTAGTGAGGCCCGATCATTTGGTGCT

[0088] R-SE1-R: ACGTATACCTATCATTATGGATGAGTGCATGG

[0089] PCR conditions: 95°C, 3min; 95°C, 30s; 61°C, 30s; 72°C, 1min 10s; cycles30; 72°C, 5min; 12°C storage.

[0090] The PCR product and the T vector were ligated with three fragments using Exnase recombinase to obtain pT-Ad7(L+R).

[0091] 2. Constr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the field of biotechnology and specifically discloses a replication-deficient type human type 7 adenovirus and a preparation method and an application thereof. In thereplication-deficient type human type 7 adenovirus, E1 gene and E3 gene are deleted, E4 gene open reading frames 2, 3, 4, 6 and 6 / 7 are replaced into a corresponding reading frame of Ad5 genome, and aE1 gene region can integrate foreign gene expression box. The replication-deficient type 7 adenovirus can be successfully rescued and mass-produced in HEK293, but does not have replication ability inhuman normal cell lines; and after the replication-deficient type 7 adenovirus carrying foreign genes infects cells, efficient expression of the foreign genes can be realized. The replication-deficient type 7 adenovirus can potentially be applied in development of preventive vaccines against human type 7 adenovirus infection; neutralizing antibodies and drug screening against human type 7 adenovirus infection; application as a gene carrier for development of vaccines for other pathogens; and report tracking systems for biological research, etc.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a replication-deficient recombinant human type 7 adenovirus and its preparation method and application. Background technique [0002] Human adenovirus (Ad) is a non-enveloped double-stranded DNA virus belonging to the family Adenoviridae and the genus Mammalian Adenovirus. Human adenovirus infection often leads to acute respiratory disease, conjunctivitis, gastroenteritis and so on. Human adenoviruses can be divided into seven subgroups, A-G, and more than 90 genotypes have been reported so far. Subgroup B adenoviruses frequently cause outbreaks in humans and cause acute respiratory disease. Subgroup B adenoviruses include genotypes 3, 7, 11, 14, 16, 21, 34, 35, 50, and 55. Among them, adenovirus type 7 (Ad7) infection often leads to acute respiratory diseases, pharyngoconjunctival fever, neurological diseases, and even severe pneumonia. About 1 / 5 adenovirus infection worldwide is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/01C07K16/08A61K39/235A61P31/20C12R1/93
CPCA61K39/12A61P31/20C07K14/005C07K16/081C12N7/00C12N2710/10021C12N2710/10022C12N2710/10034
Inventor 陈凌冯立强
Owner GUANGZHOU N BIOMED LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More