Auxiliary diagnose method, reagent kit and system of bladder cancer through union of drive gene point mutation and methylation, and application
A point mutation and methylation technology, which can be used in biochemical equipment and methods, DNA/RNA fragments, determination/inspection of microorganisms, etc. rate, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 Preparation of Urinary Bladder Cancer Driver Gene Point Mutation Methylation Combined Auxiliary Diagnostic Kit
[0030] 1. Primer probe design
[0031] 1) Driver gene point mutation targets and primers and probes
[0032] FGFR3 exon7
[0033] GTGCTGGGTGAGGGCCCTGGGGCGGCGCGGGGGTGGGGGCGGCAGTGGCGGTGGTGGTGAGGGAGGGGGTGGCCCCTGAGCGTCATCTGCCCCCACAGAGCGCT[C]CCCGCACCGGCCCATCCTGCAGGCGGGGCTGCCGGCCAACCAGACGGCGGTGCTGGGCAGCGACGTGGAGTTCCACTGCAAGGTGTACAGTGACGCACAGCCCCACATCCAGTGGCTCAAGCACGTGGA(SEQ ID NO:1)
[0034] c.746C>G
[0035] After heavy salt conversion:
[0036] GTGTTGGGTGAGGGTTTTGGGGCGGCGCGGGGGTGGGGGCGGTAGTGGCGGTGGTGGTGAGGGAGGGGGTGGTTTTTGAGCGTTATTTGTTTTTATAGAGCGTT[T]TTCGTATCGGTTTATTTTGTAGGCGGGGTTGTCGGTTAATTAGACGGCGGTGTTGGGTAGCGACGTGGAGTTTTATTGTAAGGTGTATAGTGACGTATAGTTTTATATTTAGTGGTTTAAGTACGTGGA
[0037] FGFR3-ARMS-F1:GAGCGTTATTTGTTTTTAGAGCGTTG (SEQ ID NO: 7)
[0038] FGFR3-ARMS-F2:TTGAGCGTTATTTGTTTTTAGAGCGTTGT (SEQ ID NO: 8)
[0039] FGFR3-ARMS-F3:GAGCGTTATTTGTTTTT...
Embodiment 2
[0111] Example 2 Optimization of primers and probes for urine bladder cancer driver gene point mutation methylation joint auxiliary diagnostic kit Screen and optimize the primer combination and primer concentration for point mutations, and perform primer set screening and concentration optimization tests according to the following table
[0112]
[0113]
[0114] The combination screening and concentration optimization of methylated primer probes are performed according to the following table:
[0115]
[0116]
[0117] According to Example 1, formula reaction system, using point mutation positive quality control, methylation positive quality control, negative quality control as the system test template, respectively for the primer combination and concentration test detection of the primer probe in the above table .
[0118] Test Results:
[0119] Primer probe combination specificity test results:
[0120]
[0121]
[0122]
[0123]
[0124] Compariso...
Embodiment 3
[0132] Example 3 Urinary Bladder Cancer Driver Gene Point Mutation Methylation Combined with Auxiliary Diagnostic Kit Detection Reaction Enzyme and Detection Procedure Optimization
[0133] Point mutation positive quality control, methylation positive quality control, and negative quality control are detection templates (10 replicates)
[0134] According to the optimization test of detection reaction enzyme and detection program according to the following table respectively:
[0135]
[0136]
[0137] The standard qPCR detection procedure is composed of the first stage, the third stage and the fourth stage in Example 1.
[0138] Test Results:
[0139]
[0140] To sum up, the optimal reaction enzyme system is Glod 360Master MIX.
[0141]
[0142] In summary, the optimal reaction detection procedure is the detection procedure of the present invention.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap