Construction method and application of a novel base conversion editing system

A construction method and technology of an editing system, applied in the field of construction of a new type of base conversion editing system, can solve problems such as inability to achieve changes, low activity of adenine deaminase, narrow mutation window of cytosine deaminase, etc., and achieve diverse sex high effect

Active Publication Date: 2022-07-26
EAST CHINA NORMAL UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, in the existing research results, the gene editing system either performs C / G editing alone to T / A (cytidine deaminase), or alone performs A / T editing to G / C (adenine deaminase). enzyme), if the two systems are directly transferred into the cell at the same time, since the action sites of the two enzymes are similar, and they are fused to cas9 at the same time, then only a certain base can be realized on one allele The editing of two single bases cannot achieve two kinds of single base changes, and there are also defects that the mutation window of cytosine deaminase is too narrow (only 4-8 bases), and the activity of adenine deaminase is not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of a novel base conversion editing system
  • Construction method and application of a novel base conversion editing system
  • Construction method and application of a novel base conversion editing system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0158] Embodiment 1, the construction of the second vector or the second nucleic acid construct

[0159] 1. Target sequences of human loci EMX1, PD-1, VEGFA

[0160] According to the working principle of CRISPR / Cas9 and BE3, ABE7.10, in NCBI, obtain the target of human locus (such as EMX1, PD-1, VEGFA) that both C or A appear in the ACBE window, as shown in Table 1 below shown.

[0161] Table 1. Target sequences of human-derived loci EMX1, PD-1, VEGFA

[0162] target name sequence (5`-3`) EMX1-BE3-sg1 SEQ ID NO. 8 AAGGACGGCGGCACCGGCGGGGG PD-1-sg1 SEQ ID NO.9 CTGCAGCTTCTCCAACACATCGG PD-1-sg2 SEQ ID NO. 10 CAGCAACCAGACCGGACAAGCTGG PD-1-sg3 SEQ ID NO. 11 GGACCGCAGCCAGCCCGGCCAGG PD-1-sg4 SEQ ID NO. 12 CTTCCACATGAGCGTGGTCAGGG VEGFA-sg2 SEQ ID NO. 13 GGCGAGCCGCGGGCAGGGGCCGG

[0163] 2. Design sgRNAoligo according to the target sequence

[0164] The construction of the target plasmid (the target plasmid is the p...

Embodiment 2

[0178] Example 2. Construction of ABE7.10 gene editing vector or nucleic acid construct

[0179] On the basis of ABE7.10 (addgene#102919), AID and Apobec1 were cloned into the C-terminus of ABE7.10 by PCR, and the wild TadA was cloned into the N-terminus of ABE7.10 to obtain as follows: Picture 1-1 and plasmids or constructs shown in 1-2.

Embodiment 3

[0180] Example 3. Design and construction of different base conversion editing systems ACBE

[0181] 1. In Picture 1-1 and Figure 1-2 On the basis of , design other different base conversion editing systems, namely, clone AID and Apobec1 into the C-terminal and N-terminal of ABE7.10 by PCR respectively, or replace the N-terminal wild TadA in ABE7.10, or clone into ABE7.10. C-terminal and then clone a T 2 A-UGI can be obtained as figure 1 plasmids shown. The primers used are shown in Table 3 below:

[0182] Table 3 Primer sequences for constructing different base conversion editing systems

[0183]

[0184]

[0185] 2. Construction of U6-sgRNA-CMV-UGI-T 2 A-GFP

[0186] The primers listed in Table 4 below were used to amplify CMV, UGI, T from BE3 (addgene#73021) and PX458 (addgene#48138) plasmids by PCR. 2 A-GFP, assembled on U6-sgRNA(EcoRV+NotI) plasmid.

[0187] Table 4 Primer sequences for constructing different base conversion editing systems

[0188]

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention provides a method for constructing a novel base conversion editing system. In addition to retaining the function of a single base gene editing system, the constructed editing system can realize the conversion of a single base C / G to T / A at a specified site, and The specified site A / T to G / C conversion can also realize the simultaneous conversion of specified site C / G to T / A, and A / T to G / C, and the base conversion editing system system includes sgRNA, Nuclease, cytosine deaminase, adenosine deaminase, and uracil glucosidase inhibitors capable of targeting DNA sequences. The invention also proposes the products prepared by the method and related uses. The invention breaks through the technical limitation that only a single type of base conversion can be performed in the prior art, can realize a wider range of DNA base changes, and further enrich the base editing toolbox.

Description

technical field [0001] The invention relates to the technical field of editing, in particular to a construction method and application of a novel base conversion editing system. Background technique [0002] Gene editing technology belongs to a new molecular biology tool for site-directed modification of DNA sequences. It can identify specific paired DNA sequences under the guidance of an artificially designed RNA sequence. By having both cytosine deaminase and adenine deaminase In a specific window, in addition to realizing the conversion of a single base C / G to T / A, it can also realize the conversion of A / T to G / C, and also realize the conversion of C / G to T / A, A / T Converting to G / C at the same time, forming two types of base conversion, modifying the protein coding, gene transcription regulation, and non-coding RNA sequence of this piece of DNA to achieve a series of new biological function changes, which can be widely used in Applications related to DNA modification, su...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/90C12N9/22C12N15/55C12N15/63
CPCC12N15/113C12N15/902C12N9/22C12N9/78C12N15/63C12Y305/04002C12Y305/04001C12N2310/10
Inventor 李大力谢玲张晓辉朱碧云刘明耀
Owner EAST CHINA NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap