Supercharge Your Innovation With Domain-Expert AI Agents!

SNP molecular marker for self-flowering and fruiting performance of Hanfu hybrid progeny and application

A molecular marker and self-flowering technology, applied in recombinant DNA technology, microbial measurement/testing, DNA/RNA fragments, etc., can solve problems such as dilemmas

Active Publication Date: 2020-03-27
CHINA AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although traditional QTL mapping can locate loci related to self-fertilizing traits, QTL mapping is in trouble due to the influence of population size and environmental factors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP molecular marker for self-flowering and fruiting performance of Hanfu hybrid progeny and application
  • SNP molecular marker for self-flowering and fruiting performance of Hanfu hybrid progeny and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] (1) Experimental plants

[0035] The experimental apple population used in the present invention is a hybrid population of 'Hanfu'×'Yueshuai' planted in the Fruit Tree Research Institute of Liaoning Academy of Agricultural Sciences, with a total of 304 strains.

[0036] This resource group was selected for unified plant management in this experiment.

[0037] (2) Sample collection

[0038] Through the self-pollination test, 43 self-fertile plants and 52 self-fertile plants were selected, and their leaves were stored in a liquid nitrogen tank in spring, and then brought back and stored in a -80°C refrigerator for future use.

[0039] (3) Population genome resequencing

[0040] DNA was extracted using the TIANGEN DNA Extraction Kit, and paired-end sequencing was performed based on the Illumina HiSeqXten sequencing platform to obtain a large number of high-quality SNPs.

[0041] (4) Genome-wide association (GWAS) analysis

[0042] Using the GLM model program of TASSEL5...

Embodiment 2

[0044] Example 2 Target DNA amplification and sequencing

[0045] (1) Design of primers

[0046] The DNA sequence of SEQ ID NO: 1 on chromosome 4 was downloaded from the GDR website (https: / / www.rosaceae.org).

[0047] The primers were designed using primer premier 5.0 software.

[0048] The DNA sequences of the designed primers are as follows:

[0049] Forward primer F: 5'GGATAAAATGACAAAAAATACCCTC 3'

[0050] Reverse primer R: 5'AGATTATTGGTAATATCATTTTAGGCTT 3'

[0051] (2) PCR amplification

[0052] Add 1uL of DNA template, 3uL of double distilled water, 5uL of 2X Taq PCR mix, 0.5uL of forward primer F and 0.5uL of reverse primer R into the 10ul reaction system.

[0053] The PCR reaction conditions were pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 50°C for 30 s, 34 cycles, and finally extension at 72°C for 10 min.

[0054] (3) DNA sequence determination

[0055] The PCR product was sent to Sangon Bioengineering (Shanghai) Co., Ltd. fo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an SNP molecular marker for self-flowering and fruiting performance of a Hanfu hybrid progeny and an application. The SNP site of self-flowering and fruiting performance of the Hanfu hybrid progeny corresponds to the 25831655th mutation on the chromosome No. 4 of the reference sequence of a Golden apple genome GDDH13v1.1 version. The invention also provides a primer used for identifying the above-mentioned SNP molecular marker. According to the invention, high-efficiency and accurate molecular marker assisted breeding is established through the molecular marker and theprimer; and through optimization of dominant alleles of the SNP molecular marker, a line with high self-flowering and fruiting performance in the Hanfu hybrid progeny can be selected, so an apple variety with self-flowering and fruiting performance is cultivated.

Description

technical field [0001] The invention relates to the technical field of biological breeding, in particular to a SNP molecular marker located on chromosome 4 of apple and related to the self-flowering trait of 'Hanfu' apple and its application. Background technique [0002] Apple is one of the most important fruit trees in the world. The traditional method of cultivating new varieties is mainly cross breeding, while the conventional cross breeding method has a long cycle, slow speed and low efficiency. Due to the complex genetic background of apple, long life cycle, long seedling period of hybrid seedlings, extensive segregation and variation of traits of hybrid offspring, and very high heterozygosity, it has brought great difficulties to the breeding of specific excellent traits. Therefore, molecular marker-assisted breeding can be screened in the early stage of breeding, and has the advantages of high efficiency, rapidity, stability and reliability. [0003] In nature, most...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 李天忠于杰刘志姜峰李洋刘春生
Owner CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com